ID: 1037892070

View in Genome Browser
Species Human (GRCh38)
Location 8:22628759-22628781
Sequence GGCACAGAAAAGCCCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037892056_1037892070 30 Left 1037892056 8:22628706-22628728 CCATGGGTGCCTGTGGCAGCCTC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892062_1037892070 2 Left 1037892062 8:22628734-22628756 CCGTCTCTGGGACCCCTGTGGCC 0: 1
1: 1
2: 1
3: 49
4: 350
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892060_1037892070 11 Left 1037892060 8:22628725-22628747 CCTCTGTGTCCGTCTCTGGGACC 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892057_1037892070 21 Left 1037892057 8:22628715-22628737 CCTGTGGCAGCCTCTGTGTCCGT 0: 1
1: 0
2: 2
3: 17
4: 190
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892064_1037892070 -10 Left 1037892064 8:22628746-22628768 CCCCTGTGGCCCTGGCACAGAAA 0: 1
1: 0
2: 2
3: 46
4: 345
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037892070 Original CRISPR GGCACAGAAAAGCCCTCTGT GGG Intronic
No off target data available for this crispr