ID: 1037893830

View in Genome Browser
Species Human (GRCh38)
Location 8:22638585-22638607
Sequence CCTTTTGGACAGCAGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037893824_1037893830 10 Left 1037893824 8:22638552-22638574 CCAGATACAAATTTACTTGCTGA 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1037893830 8:22638585-22638607 CCTTTTGGACAGCAGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037893830 Original CRISPR CCTTTTGGACAGCAGGAATG AGG Intronic
No off target data available for this crispr