ID: 1037895978

View in Genome Browser
Species Human (GRCh38)
Location 8:22655967-22655989
Sequence GATTTGCTTTGCTAAGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037895978_1037895981 4 Left 1037895978 8:22655967-22655989 CCTGATACTTAGCAAAGCAAATC 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1037895981 8:22655994-22656016 CTCATTAAAAATTTTTTTCCAGG No data
1037895978_1037895982 15 Left 1037895978 8:22655967-22655989 CCTGATACTTAGCAAAGCAAATC 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1037895982 8:22656005-22656027 TTTTTTTCCAGGTAATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037895978 Original CRISPR GATTTGCTTTGCTAAGTATC AGG (reversed) Intronic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
904945300 1:34194846-34194868 GGCTTGCTTTGCAAAGTATTTGG + Intronic
908141655 1:61191395-61191417 GATTTGCTTTCCGGAGAATCTGG + Intronic
909067057 1:70947686-70947708 GATTTGGGTTGCTGAGTTTCAGG + Intronic
909870293 1:80730252-80730274 TATTTGGTTTGCTGAGTATGAGG + Intergenic
911307945 1:96254417-96254439 GATTTTCTTTACCTAGTATCTGG + Intergenic
911380490 1:97107586-97107608 CATGTGCTTTGCAAAGTGTCTGG - Intronic
917338030 1:173945445-173945467 GTTTTGTTTTTCTAAGTGTCAGG + Intronic
917695485 1:177518749-177518771 TCTTTGCTTTGCTCAGTGTCTGG + Intergenic
918458334 1:184750466-184750488 GTTTTCCTTTGCTAATTATTTGG - Intronic
920058324 1:203209554-203209576 GATTTGCTGTAATAAATATCAGG + Intergenic
921442157 1:215200283-215200305 GTTTTGTTTTGCTAATTACCTGG + Intronic
924560269 1:245153203-245153225 GATTTGCATTTCTAAGTAGCTGG - Intergenic
1063400091 10:5735241-5735263 GAAAAGCTATGCTAAGTATCTGG + Intronic
1063813262 10:9739328-9739350 ACTTGGCTTTACTAAGTATCGGG - Intergenic
1065092392 10:22248004-22248026 AATTTGTTGTGCTAAGTGTCAGG - Intergenic
1065194822 10:23253552-23253574 GATTTGTTTTCCTAATTTTCTGG - Intergenic
1065554233 10:26898806-26898828 GAATTCCTTTGCTAAGGATAAGG - Intergenic
1070424748 10:76274638-76274660 GAGCTGCTTTGCTATGTATCAGG + Intronic
1070489563 10:76964041-76964063 GATTTGCTCTGCAAAGCCTCAGG - Intronic
1080164167 11:29216708-29216730 ATTTTGCTTTGCTAGGTATGGGG + Intergenic
1080273577 11:30477603-30477625 GATTTGATTTGCTAACCTTCCGG + Intronic
1081349768 11:42036436-42036458 GAATTGCTTTGCTAAGTAAAGGG + Intergenic
1082673747 11:56069749-56069771 GATTTGCTTTGCTTTTTCTCAGG + Intergenic
1086813146 11:91335664-91335686 GATCTGCCTTACCAAGTATCTGG + Intergenic
1087443139 11:98210148-98210170 GTTTTGCTTTTCTTAGTATATGG + Intergenic
1087943865 11:104134928-104134950 GATTTCCTGTGATAAGTAGCTGG - Intronic
1089386251 11:118070109-118070131 CATTTGTTTTTCTCAGTATCCGG - Intergenic
1090500812 11:127258772-127258794 CATTTACTTTGCTAGGTATTGGG - Intergenic
1091882915 12:3994034-3994056 GAATTGCTGTGGTAGGTATCAGG + Intergenic
1092559631 12:9598125-9598147 GAATTGCTTTGTCACGTATCAGG + Exonic
1093471721 12:19509340-19509362 CATTTGTTTTACTAAGTATGTGG - Intronic
1093800472 12:23366277-23366299 GATTTCCTATACTAAATATCAGG + Intergenic
1094151117 12:27284699-27284721 GATTTGTTTTCCTAATAATCCGG + Intronic
1095180212 12:39138549-39138571 TATTTGCTTCGCTTGGTATCAGG - Intergenic
1095211066 12:39495537-39495559 GAATTCCTCTGCCAAGTATCAGG + Intergenic
1095358453 12:41306075-41306097 AATTTGCCTTGTTAAGTTTCAGG - Intronic
1098048263 12:66425236-66425258 GATTTGCATTTCTCAGCATCAGG - Intronic
1100220537 12:92500246-92500268 GATTTGGTTTGAAAAGCATCTGG + Intergenic
1103070135 12:117934518-117934540 GCTTTGCTTTGTCAAGTACCTGG + Intronic
1107375565 13:39800550-39800572 TATTTTCTTTGCTAATTATAGGG + Intergenic
1108951939 13:56105245-56105267 GATTTTCCTTGTTAGGTATCAGG + Intergenic
1110164306 13:72420084-72420106 CTTTTGCTTTGCTAAGAATGAGG - Intergenic
1112838122 13:103541917-103541939 CATTTCCTTTGCTGAGTACCTGG - Intergenic
1114941405 14:27615038-27615060 TATTTCCTTTGCTAAGTACAGGG + Intergenic
1115962910 14:38855724-38855746 GATTTGCTTTCCCAAGGACCAGG + Intergenic
1117167512 14:53052620-53052642 GATTTGCTTTACTAATTATTTGG - Intronic
1118675518 14:68180684-68180706 GATCTGCTTCTCTAAGTAGCTGG + Intronic
1122181086 14:99955315-99955337 GTTTTGCTTTGATAACTTTCTGG - Intergenic
1123976253 15:25557199-25557221 GTTTTGCTTTAGAAAGTATCTGG - Intergenic
1124108905 15:26768771-26768793 AATTTTCTTTGACAAGTATCAGG + Intronic
1127558062 15:60107804-60107826 GATTGGATATGCTAAGGATCAGG + Intergenic
1134886158 16:17794122-17794144 TATTTGCTTTTCTAATTATTGGG - Intergenic
1138664504 16:58553562-58553584 GATTATCTTTTCTAAGTAGCAGG - Intronic
1141899192 16:86979145-86979167 GATGTGTTTGACTAAGTATCTGG - Intergenic
1143409749 17:6701826-6701848 GATTTCCTTTGCTAAGTGGGGGG - Intronic
1153452631 18:5246699-5246721 GATTTGTTTTGTTAATTGTCTGG + Intergenic
1154363100 18:13681722-13681744 GATTTGTCTTGCAAAGGATCAGG + Exonic
1155206938 18:23566945-23566967 GATTGGCTTTGCTTAGTAATAGG + Intronic
1156039192 18:32800742-32800764 GATCTGCTTAGTTAGGTATCTGG + Intergenic
1158369511 18:56784026-56784048 GTCAGGCTTTGCTAAGTATCTGG + Intronic
1158783288 18:60677848-60677870 GATTTGCTTTGTTAGTTATTTGG + Intergenic
1159940947 18:74407961-74407983 TATTTGCTTTGCTTCGTATTTGG + Intergenic
1161771789 19:6234770-6234792 TTTTTGCTTTGCTATGTATTTGG - Intronic
1164104260 19:22092670-22092692 AATTTGCTTTGGTAAGTACTAGG + Intergenic
925702374 2:6651513-6651535 GATTTTCTTAGATAAGTATGTGG + Intergenic
926653729 2:15375262-15375284 GATTTGCTAAGCTAAGAATGTGG + Intronic
928151005 2:28829133-28829155 GATCTTCTTTGTTAGGTATCTGG + Exonic
930068154 2:47343617-47343639 TCTTTGCTTAGCTAAGTATTGGG - Intergenic
932297023 2:70633762-70633784 TATTTACTTTGCTAAATATTTGG + Intronic
933009858 2:77046915-77046937 CAGTTGCATTTCTAAGTATCAGG - Intronic
939212555 2:139195462-139195484 GCCATACTTTGCTAAGTATCGGG + Intergenic
939251488 2:139686525-139686547 GATTTGATTTGCTGAAGATCAGG + Intergenic
940242886 2:151582275-151582297 CATTTGCTTTGATAAGTGTTTGG - Intronic
940243841 2:151592827-151592849 CATTTGCTTTGATAAGTGTTTGG - Intronic
940244800 2:151603380-151603402 CATTTGCTTTGATAAGTGTTTGG - Intronic
941031190 2:160513417-160513439 GATTAGCTCTGCAAATTATCTGG - Intergenic
945606904 2:211944818-211944840 GATTTGCATTTCTAAGTTCCTGG + Intronic
946134609 2:217635511-217635533 GCTTTGTTTTGCTCAGTTTCAGG - Intronic
946735512 2:222750695-222750717 GCTTTCCTTTGATAAGAATCAGG + Intergenic
1171395046 20:24827302-24827324 AATTTGCTTTGAAAAGTTTCTGG - Intergenic
1171472640 20:25384196-25384218 GTTTTGCTTTGCATGGTATCTGG - Intronic
1176694602 21:9959346-9959368 GACTTGCTTTGCCAAGTGTATGG - Intergenic
1180719692 22:17898294-17898316 AAATTGCCTTGCTAATTATCTGG - Intronic
1181785984 22:25227702-25227724 GATTTGCTGTGCTAAGGTTTGGG + Intronic
1181818174 22:25455561-25455583 GATTTGCTGTGCTAAGGTTTGGG + Intergenic
1184300041 22:43553304-43553326 GAGTTGCTTTGTTAAGTATTTGG + Intronic
949714177 3:6909380-6909402 CATTTGCCTTTCTAATTATCTGG + Intronic
950989413 3:17416784-17416806 GATTTGCCTTTCTAACTTTCAGG - Intronic
952120031 3:30231445-30231467 GATTTGAGTTACTAAGGATCTGG + Intergenic
955466992 3:59247730-59247752 GATATGCTCTGCTAAGAACCAGG + Intergenic
955644761 3:61125548-61125570 GATTTGATTTGCAAAGTTTCTGG - Intronic
955866937 3:63394499-63394521 TATTTGCTTTCTTAAGAATCTGG + Intronic
959457753 3:106584465-106584487 GCTTTGCTCTGCAAAGTGTCAGG + Intergenic
960065114 3:113363423-113363445 GATTTGTTTTGCAAAATCTCAGG + Intronic
963512582 3:146267312-146267334 GATTTGCTTTGCCATGTCTCTGG + Intergenic
970071652 4:12166024-12166046 GATTTGCTTATATAAGTATAAGG - Intergenic
970249145 4:14095571-14095593 GATCTGCTTTGCTAATAATAAGG - Intergenic
974279280 4:59770753-59770775 CAGCTGCTTTGCTAAGTATTGGG - Intergenic
974332787 4:60501235-60501257 GATTTGTTTTGCCAAGGATGTGG - Intergenic
976381114 4:84400103-84400125 GATTTGTTTTGTTAAGTAGGAGG + Intergenic
976869491 4:89773802-89773824 GTTTTGCTTTGCTCAATATTAGG + Intronic
977574823 4:98664730-98664752 TCTTTGCTCTGCTCAGTATCAGG - Intergenic
977780450 4:100975517-100975539 TATTCGCTTTGCTAAGTAATTGG + Intergenic
980669356 4:135983923-135983945 GATTTCCCTTGCTAGGTAACTGG + Intergenic
981091606 4:140738067-140738089 GATTTTCTTTGTTTAATATCTGG - Intronic
982933878 4:161444957-161444979 AAATTGCTTAGCTCAGTATCTGG + Intronic
985748008 5:1658158-1658180 GCTCTGCTTTGCAAAGTATCAGG + Intergenic
986373806 5:7109614-7109636 GATTTGCCTTGGTCATTATCTGG - Intergenic
990031821 5:51270535-51270557 AATTTACTTTTCTAAGTTTCTGG + Intergenic
990472093 5:56125049-56125071 GATTTTCTTTGCTAAGTGGGTGG + Intronic
990970818 5:61503737-61503759 GATATTCTTTGCTAAGCATTAGG + Intronic
991070556 5:62475040-62475062 GTTTTGCTTTCCTCAGTATCAGG - Intronic
992474145 5:77086537-77086559 TTTTTGCTTTGCTAAGCCTCGGG + Intronic
994057505 5:95434891-95434913 CATTTGCTTCGCAAAGGATCTGG - Intronic
994689138 5:102995084-102995106 GATTTGCTTCGCTAGTTTTCTGG + Intronic
994713390 5:103293259-103293281 GATTTGCTTTGCTGACTCTGAGG + Intergenic
995499755 5:112791668-112791690 GATTTGTTTTAATAAATATCAGG - Intronic
995892970 5:116977404-116977426 GATGTGCTTTGTTAGTTATCAGG - Intergenic
996003421 5:118390918-118390940 GATTTACTTTTCTAAGTGACTGG - Intergenic
997071182 5:130624022-130624044 GATTGGCTTTCTTAAGTATAAGG - Intergenic
998821136 5:146059023-146059045 TATTTGGTGTGCAAAGTATCAGG - Intronic
1005255746 6:24001181-24001203 GATTTGCTTTGACAGGTATGTGG + Intergenic
1005339904 6:24833973-24833995 GGTTTGCTTGGCATAGTATCAGG + Intronic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1009857050 6:69277894-69277916 GAAATGCTTTGAAAAGTATCTGG + Intronic
1010437843 6:75856064-75856086 AATTTGCTTAGCAAAGAATCAGG - Intronic
1010637944 6:78283468-78283490 GATCTGCCTTGCTAAGTGTGTGG - Intergenic
1012625560 6:101400240-101400262 GTATTGCTTTTCTAAGAATCAGG + Intronic
1012900609 6:105001550-105001572 GTTTAGGTTTGATAAGTATCAGG + Intronic
1014289657 6:119543537-119543559 GGTTTCCTGTGGTAAGTATCTGG - Intergenic
1014308181 6:119767681-119767703 CTTTTGCTTTGTTAAGAATCTGG - Intergenic
1014691249 6:124565955-124565977 GATTTGCTGTGCTAAGCAGTAGG + Intronic
1014805956 6:125829842-125829864 CATTTTCTTTTCTAAGTGTCAGG + Intronic
1015903427 6:138091112-138091134 GACTTGCTTTTCTAAATCTCAGG - Exonic
1020485167 7:8712389-8712411 GATTTACTTTGCTAAGCATCAGG - Intronic
1024320222 7:48059035-48059057 GATCTGCTCTGCTTAGTTTCTGG + Intronic
1027722374 7:81760956-81760978 GTTTTTCTTTCCTAAGTATACGG + Intronic
1030022168 7:105286369-105286391 GATTTACTATGCTAAGTGTTTGG + Intronic
1030255637 7:107506609-107506631 GATCTGCCTTGCGAAGTATGCGG - Intronic
1030768056 7:113436830-113436852 GATTTTTTTTTCTAATTATCAGG + Intergenic
1031276147 7:119725859-119725881 GATTTGTATTTCTAAGTATCGGG + Intergenic
1032870406 7:135978614-135978636 GATTTGTATTTCTAATTATCAGG - Intergenic
1033455743 7:141501891-141501913 GTTTTCCTCTGCTAAGTAGCAGG - Intergenic
1033883750 7:145918680-145918702 TATTTGCTTAGCTAATTATTAGG - Intergenic
1037895978 8:22655967-22655989 GATTTGCTTTGCTAAGTATCAGG - Intronic
1038735836 8:30168644-30168666 GTTTTCCTTTGCTAAGTTTCAGG + Intronic
1039818767 8:41118040-41118062 GAGTTGTTTTTCTAAGCATCTGG - Intergenic
1040441136 8:47443594-47443616 GTTTTGTTTTGTTAAGTATGAGG - Intronic
1043462822 8:80478043-80478065 CATTTGCTTTGAGAACTATCTGG - Intergenic
1048238182 8:132713196-132713218 GATTCGATTTTCTAAATATCAGG + Intronic
1048897421 8:139004961-139004983 GATTGGCTTCACTAAGTATAAGG + Intergenic
1049930423 9:450917-450939 GAGTTGCTTTTCTAAAAATCAGG - Intronic
1051181192 9:14413500-14413522 GTTTTGCTTTTCTGAGTCTCAGG + Intergenic
1051193687 9:14540112-14540134 GATTTGATTTGCTAAATATCCGG + Intergenic
1057453181 9:95183540-95183562 AATTTGCTTTCCTAAGTTGCAGG + Intronic
1058340391 9:103888236-103888258 AATTTGCTTTGCTCAGTCTATGG + Intergenic
1058372502 9:104285948-104285970 GATTTACTTAGATAAGTATGAGG - Intergenic
1059127668 9:111708555-111708577 ATTTTGTTTTGCTAAATATCAGG + Intronic
1059370072 9:113823322-113823344 AATTTTCTTAGCTAAATATCTGG - Intergenic
1060059175 9:120443789-120443811 CAGTTGCTTGGCTAAGTTTCAGG - Intronic
1060096498 9:120795114-120795136 AATTTGATTTGCTAAGCAACAGG + Intergenic
1187637582 X:21248693-21248715 GATGTGGTTTACTAAGTCTCTGG - Intergenic
1187650956 X:21405447-21405469 AATTGGCTTTGCTGAGTATGGGG + Intronic
1187656792 X:21484744-21484766 TATTTGCTTTTCTAAGTAAGTGG - Intronic
1188436481 X:30165467-30165489 TATTTGCTATGCTCAGTTTCAGG + Intergenic
1188459407 X:30406131-30406153 CATTTGTTTTGTTGAGTATCAGG - Intergenic
1188634512 X:32412267-32412289 GATTTGGTTTGCTTAGAATAGGG + Intronic
1188944093 X:36276595-36276617 GATTTGCTTAGGTCAGTGTCAGG + Intronic
1192140491 X:68643886-68643908 GATGTGCTCTGCTCAATATCTGG + Intergenic
1192486889 X:71534940-71534962 ACTTTGCTTTCCTCAGTATCCGG + Intronic
1194776736 X:97974304-97974326 GATTTGCTTTTATCAGTATTTGG + Intergenic
1197806445 X:130402585-130402607 CATTTGCTGTGCTAAGGTTCAGG + Intronic
1201330758 Y:12817863-12817885 TATATGCTTTGCTCTGTATCTGG - Intronic
1202035894 Y:20634836-20634858 GATTGGATTTGCTTTGTATCTGG - Intergenic