ID: 1037896253

View in Genome Browser
Species Human (GRCh38)
Location 8:22658285-22658307
Sequence CTGTGTGTACGGAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037896238_1037896253 28 Left 1037896238 8:22658234-22658256 CCTCCTCTTCTCCAACCCCCAAC 0: 1
1: 0
2: 10
3: 96
4: 953
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896241_1037896253 13 Left 1037896241 8:22658249-22658271 CCCCCAACTGCCCCACCGCAAAA 0: 1
1: 0
2: 2
3: 19
4: 219
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896246_1037896253 2 Left 1037896246 8:22658260-22658282 CCCACCGCAAAAAAGAAAAAAAG 0: 1
1: 3
2: 84
3: 1384
4: 12341
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896243_1037896253 11 Left 1037896243 8:22658251-22658273 CCCAACTGCCCCACCGCAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 258
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896242_1037896253 12 Left 1037896242 8:22658250-22658272 CCCCAACTGCCCCACCGCAAAAA 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896244_1037896253 10 Left 1037896244 8:22658252-22658274 CCAACTGCCCCACCGCAAAAAAG 0: 1
1: 0
2: 1
3: 25
4: 251
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896245_1037896253 3 Left 1037896245 8:22658259-22658281 CCCCACCGCAAAAAAGAAAAAAA 0: 1
1: 12
2: 294
3: 3536
4: 13595
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896239_1037896253 25 Left 1037896239 8:22658237-22658259 CCTCTTCTCCAACCCCCAACTGC 0: 1
1: 0
2: 4
3: 70
4: 606
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896247_1037896253 1 Left 1037896247 8:22658261-22658283 CCACCGCAAAAAAGAAAAAAAGT 0: 1
1: 1
2: 110
3: 2705
4: 21751
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896248_1037896253 -2 Left 1037896248 8:22658264-22658286 CCGCAAAAAAGAAAAAAAGTTCT 0: 1
1: 7
2: 79
3: 736
4: 3918
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896237_1037896253 29 Left 1037896237 8:22658233-22658255 CCCTCCTCTTCTCCAACCCCCAA 0: 1
1: 1
2: 7
3: 105
4: 918
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data
1037896240_1037896253 17 Left 1037896240 8:22658245-22658267 CCAACCCCCAACTGCCCCACCGC 0: 1
1: 0
2: 6
3: 68
4: 632
Right 1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037896253 Original CRISPR CTGTGTGTACGGAGGGCAAA GGG Intronic
No off target data available for this crispr