ID: 1037900480

View in Genome Browser
Species Human (GRCh38)
Location 8:22685431-22685453
Sequence GCGCGCGCGCGCGCGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037900473_1037900480 15 Left 1037900473 8:22685393-22685415 CCCAAGTGGTGTGTGTGTGTGTG No data
Right 1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG No data
1037900474_1037900480 14 Left 1037900474 8:22685394-22685416 CCAAGTGGTGTGTGTGTGTGTGT No data
Right 1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037900480 Original CRISPR GCGCGCGCGCGCGCGGGGAG GGG Intergenic
No off target data available for this crispr