ID: 1037903836

View in Genome Browser
Species Human (GRCh38)
Location 8:22703782-22703804
Sequence GAGCGGCGCCGCCCGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037903836_1037903851 26 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903851 8:22703831-22703853 CCTGGTGTCCGGGTGCCAGGGGG No data
1037903836_1037903846 23 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903846 8:22703828-22703850 ATCCCTGGTGTCCGGGTGCCAGG No data
1037903836_1037903843 8 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903843 8:22703813-22703835 CAGAGACTGGTTCGAATCCCTGG No data
1037903836_1037903840 -5 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903840 8:22703800-22703822 CGCTCGGCCTCCTCAGAGACTGG No data
1037903836_1037903844 15 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903844 8:22703820-22703842 TGGTTCGAATCCCTGGTGTCCGG No data
1037903836_1037903847 24 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903847 8:22703829-22703851 TCCCTGGTGTCCGGGTGCCAGGG No data
1037903836_1037903849 25 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903849 8:22703830-22703852 CCCTGGTGTCCGGGTGCCAGGGG No data
1037903836_1037903845 16 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903845 8:22703821-22703843 GGTTCGAATCCCTGGTGTCCGGG No data
1037903836_1037903852 29 Left 1037903836 8:22703782-22703804 CCGGGCCGCGGGCGGCGCCGCTC No data
Right 1037903852 8:22703834-22703856 GGTGTCCGGGTGCCAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037903836 Original CRISPR GAGCGGCGCCGCCCGCGGCC CGG (reversed) Intergenic