ID: 1037903910

View in Genome Browser
Species Human (GRCh38)
Location 8:22704141-22704163
Sequence CTCCAGAAGGGAGAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037903910_1037903923 11 Left 1037903910 8:22704141-22704163 CCCCCCAACTCTCCCTTCTGGAG No data
Right 1037903923 8:22704175-22704197 CCCGACATGACACCAGAGGCTGG No data
1037903910_1037903925 12 Left 1037903910 8:22704141-22704163 CCCCCCAACTCTCCCTTCTGGAG No data
Right 1037903925 8:22704176-22704198 CCGACATGACACCAGAGGCTGGG No data
1037903910_1037903920 7 Left 1037903910 8:22704141-22704163 CCCCCCAACTCTCCCTTCTGGAG No data
Right 1037903920 8:22704171-22704193 GCACCCCGACATGACACCAGAGG No data
1037903910_1037903926 13 Left 1037903910 8:22704141-22704163 CCCCCCAACTCTCCCTTCTGGAG No data
Right 1037903926 8:22704177-22704199 CGACATGACACCAGAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037903910 Original CRISPR CTCCAGAAGGGAGAGTTGGG GGG (reversed) Intergenic
No off target data available for this crispr