ID: 1037904265

View in Genome Browser
Species Human (GRCh38)
Location 8:22706188-22706210
Sequence CAGTGTGGTGGGAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037904265_1037904270 2 Left 1037904265 8:22706188-22706210 CCATCTTCTCTCCCACCACACTG No data
Right 1037904270 8:22706213-22706235 AGAGCAGAAGAGCTTCCAGAAGG No data
1037904265_1037904271 14 Left 1037904265 8:22706188-22706210 CCATCTTCTCTCCCACCACACTG No data
Right 1037904271 8:22706225-22706247 CTTCCAGAAGGCAGAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037904265 Original CRISPR CAGTGTGGTGGGAGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr