ID: 1037912132

View in Genome Browser
Species Human (GRCh38)
Location 8:22749745-22749767
Sequence TCCACACTGCTGCCCGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037912132 Original CRISPR TCCACACTGCTGCCCGTGAC TGG (reversed) Intronic
900648153 1:3718233-3718255 TCCACAGTGCTCCCCGCGCCTGG + Intronic
902116352 1:14124880-14124902 TCCCCAGTGCTGCCCCCGACAGG - Intergenic
903322731 1:22552545-22552567 TCCACACTGCAGTCAGTGCCAGG + Intergenic
904329031 1:29745905-29745927 GCCACACAGCTGGCTGTGACAGG - Intergenic
904337212 1:29805698-29805720 ACCACACTGCTGCTAGGGACTGG - Intergenic
905205283 1:36339900-36339922 TCCAGGCTGCTGCCCGTGCGTGG - Exonic
907047874 1:51311089-51311111 TTCACACTCCTGCCCCTGGCGGG - Intronic
907333008 1:53683656-53683678 TCCACATGCCTGCCCGTGCCAGG - Intronic
907798775 1:57743542-57743564 TCCACACGGATGCGCGTGAAAGG + Intronic
908923856 1:69229648-69229670 TCCACACTGCTGCCAGAGTCAGG + Intergenic
913089135 1:115464769-115464791 TCCACACTGGGGCCTGTGAGGGG + Intergenic
915448609 1:155989393-155989415 TCCTCCCTGGTGCCCGTCACTGG - Intronic
916575910 1:166066270-166066292 CCCACACTGCAGCCCCTGTCAGG + Intronic
916851868 1:168712300-168712322 TCCCCACTGCAGCCCGTGCAGGG + Intronic
917145604 1:171887285-171887307 GCCACACTGCAGTCAGTGACTGG + Intronic
917857229 1:179110641-179110663 TCCACGCTGCTGCATGTGGCAGG + Intronic
919785506 1:201255547-201255569 TCCACCCTGCAGCCCTTGGCAGG + Intergenic
920255158 1:204649743-204649765 CCCACACTGATCCCCATGACTGG + Intronic
1063461741 10:6219193-6219215 TCCGCAATGCTCCCCGTGCCGGG - Intronic
1065488940 10:26262982-26263004 TCCTTACTGCTGCCCTTGAAGGG - Intronic
1067415620 10:46099438-46099460 TCCACACTCCTGCCCTAGAGAGG - Intergenic
1068750962 10:60591759-60591781 TCCACATTGCTGCAAATGACTGG - Intronic
1072973983 10:100041809-100041831 TCCACACTGCATCCAGAGACTGG - Intergenic
1075786981 10:125056784-125056806 TCCGCATTGCTGCCCGTGATGGG - Intronic
1076000783 10:126911460-126911482 TCCACACTGGTGCATGTGCCCGG - Intronic
1076138054 10:128058469-128058491 CCCACGCAGCTGCCCGGGACTGG + Intronic
1077702087 11:4452010-4452032 TCCACGTTGCTGCAAGTGACAGG + Intergenic
1078292649 11:10028472-10028494 GCCACACTAGTGCCCGTGATAGG + Exonic
1078749063 11:14142924-14142946 TCCACACTGCCCCCAGTGTCAGG + Intronic
1078815958 11:14822868-14822890 TCAACACTGCTACCAGTGGCTGG - Intronic
1079936141 11:26618777-26618799 TCCACAGTGCTTCCTGTGTCTGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082864012 11:57881969-57881991 TCCACACAGCTGCCCATAACAGG + Intergenic
1083083192 11:60114620-60114642 TCCACACTGCTGCTGCTGGCTGG - Intergenic
1083793047 11:64998368-64998390 TCCACACCTCTGCCCATAACAGG - Intergenic
1084449572 11:69228007-69228029 TGCACCCTGCTGCCTCTGACAGG - Intergenic
1089448474 11:118572674-118572696 GCCACACTGCTCCCCGAGCCCGG - Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090404520 11:126468735-126468757 TCCTTACTCCTGCCCTTGACAGG + Intronic
1091703637 12:2679705-2679727 TCCACAGTGCTGACCGTGCTGGG - Exonic
1096220519 12:49826018-49826040 TCCTCACTGCTGCCACTGGCTGG + Intronic
1097736432 12:63186912-63186934 TCCACATTGCTGCTAATGACAGG + Intergenic
1099808615 12:87551957-87551979 TCCACGTTGTTGCCAGTGACAGG - Intergenic
1102419942 12:112795523-112795545 CCCACACTGCAGCCCCTGGCTGG - Intronic
1103901730 12:124306963-124306985 TCCAGACTGGTGCTCGTGCCTGG - Intronic
1104823853 12:131694540-131694562 TGCACACAGCTGCCTGTGCCTGG + Intergenic
1104918656 12:132279245-132279267 CCCAGACTGCTGGCTGTGACTGG + Intronic
1104961142 12:132489363-132489385 TCCACACTGCGCTCCGTGTCTGG + Intergenic
1104967086 12:132513241-132513263 TCCAATCTGCTGCCTGTGATGGG - Intronic
1111445301 13:88339615-88339637 TCCACCCTGCTGCTGGTGGCTGG + Intergenic
1113251112 13:108453585-108453607 TCCACACTGCTGCAAATGACAGG - Intergenic
1113445130 13:110360125-110360147 TCCACCCCGCAGCCCTTGACTGG + Intronic
1116948371 14:50856957-50856979 TCCACACTGCTGTCCTCGCCTGG + Intergenic
1117520594 14:56547813-56547835 TCAACACTGCAGCCAGTCACAGG - Intronic
1119089055 14:71763381-71763403 TCCACACTCCTGCCTGCCACTGG + Intergenic
1119330553 14:73790113-73790135 TCCACACTGCTGCCAGGGCGAGG + Intronic
1120170138 14:81239830-81239852 TCCACGTTGCTGCACATGACAGG + Intergenic
1120962241 14:90136026-90136048 ACCATACTGCTGCCCGGGCCAGG - Intronic
1122166293 14:99826800-99826822 TCCACACTGCTGCCAAGGAGTGG + Intronic
1122530144 14:102419526-102419548 CCTACACTGCTGCCCATGAGAGG - Intronic
1122724626 14:103742092-103742114 CCCACCCTGCTGCCCGCCACAGG - Exonic
1122899307 14:104775619-104775641 TCCCCACTTCTGCCTGTGCCTGG - Intronic
1124401120 15:29348434-29348456 TCCACACTGCTCCCTGAGTCGGG - Intronic
1130044113 15:80430822-80430844 TGCCCACTGCTGCCCTGGACAGG - Intronic
1131423269 15:92325280-92325302 TCCAACCTGCTGGCCATGACAGG - Intergenic
1135455540 16:22593704-22593726 CCCACACTGCTGCCCAGGAAAGG - Intergenic
1141175326 16:81714617-81714639 TTCACACTGCTCCCAATGACAGG - Intergenic
1141922450 16:87145183-87145205 TCCTCACCCCTGCCAGTGACTGG - Intronic
1141922475 16:87145345-87145367 ACCTCACCCCTGCCCGTGACTGG - Intronic
1142090824 16:88208309-88208331 TCCAGATTGCGGCACGTGACAGG - Intergenic
1142105981 16:88302999-88303021 TCCACACTGGCACCCGGGACAGG - Intergenic
1144588556 17:16504296-16504318 TCCTCATTGCTGCCTGTCACTGG + Intergenic
1144678598 17:17177559-17177581 TTCACACGGCTGCCCCAGACAGG + Intronic
1144768096 17:17743881-17743903 TCCACTCTGCAGCCCCTGGCTGG + Intronic
1147120124 17:38330834-38330856 TCCACGCTGCTGCTCTTGGCAGG + Exonic
1147460957 17:40568730-40568752 GCTACACTGTTGCCCGTGGCTGG - Intergenic
1147631916 17:41937789-41937811 ACCACACTGCTGCCAGTGACAGG + Intronic
1147725785 17:42565435-42565457 TCGGCACTGCTGGCGGTGACTGG + Intronic
1150755872 17:67912796-67912818 TCCACACTGCCGCCTGTGGAGGG - Exonic
1151551066 17:74822831-74822853 GCCACGCTGCTGCCCGGGGCTGG - Intronic
1152613725 17:81328585-81328607 CCCACACTGCTGCCCAGCACGGG - Intronic
1152780318 17:82224878-82224900 ACCACACTGCTGCCTGTGGTGGG - Intergenic
1153677705 18:7470237-7470259 TCCTCAATCCTGCCCGTGAAGGG - Intergenic
1157893664 18:51443139-51443161 TTCACACTGCTGCCTCTGTCTGG - Intergenic
1161128605 19:2574535-2574557 TCCACGCTGTAGCCCGTGTCTGG + Intronic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1164932949 19:32189244-32189266 TCCACTCTACTGCCCATCACTGG + Intergenic
1165913671 19:39244909-39244931 GCCGCAGTGCTGACCGTGACTGG - Exonic
1165917291 19:39268715-39268737 GCCGCAGTGCTGACCGTGACTGG + Exonic
1166502107 19:43349296-43349318 TCCACTCTTCTGCCCATTACAGG - Intergenic
1166508005 19:43384156-43384178 TCCACTCTTCTGCCCATTACAGG + Intergenic
1167134955 19:47610271-47610293 TCCCCGCGGCCGCCCGTGACAGG - Intronic
1167447931 19:49549834-49549856 TCCACACTGTAGCCCGTGTCAGG + Intergenic
925358183 2:3257417-3257439 TCCACACGGCTGCACATGTCAGG + Exonic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
928484694 2:31718166-31718188 GCAACACTGCTGCCAGTGGCTGG - Intergenic
930555492 2:52890061-52890083 TCCACATTGCTGCAAATGACAGG + Intergenic
931858214 2:66326461-66326483 TCCATACTGTTGCAAGTGACAGG - Intergenic
934848232 2:97677137-97677159 TCCACACTGCTGCCCGTCACAGG - Intergenic
935688290 2:105706276-105706298 TCCACATTGCTGCAAATGACAGG - Intergenic
937029396 2:118725442-118725464 TCCAAACAGCTTCCGGTGACTGG + Intergenic
937336164 2:121063593-121063615 GCCACACTGCTGCCCTGGCCTGG + Intergenic
937911689 2:127078717-127078739 TCCCCACTGCTGCCCCTCCCTGG + Intronic
938088332 2:128416475-128416497 TTCACACTGCTGCCCGGGGCAGG + Intergenic
939580107 2:143937341-143937363 TCCACACCGCTGCGCCTGAGCGG - Intergenic
941861593 2:170287033-170287055 TCCATGTTGCTGCCAGTGACAGG + Intronic
948935293 2:241160024-241160046 TTCACACTTGTGCCCATGACAGG - Intronic
1169406041 20:5322065-5322087 TCCACAATGCAGCCCCTGAGAGG + Intergenic
1170011436 20:11728203-11728225 TCCAGCCTGCTGCCACTGACTGG - Intergenic
1172035398 20:32007207-32007229 TCCCCACTCCTGCCCATGGCAGG + Intergenic
1172577589 20:36021242-36021264 TCCACGCTGCTGCAAATGACAGG - Intronic
1172596924 20:36156016-36156038 TCCACACCCTTGCCCGGGACAGG - Intronic
1172977739 20:38919346-38919368 GCCACACTTCTGCCCATGCCAGG + Exonic
1173449993 20:43155362-43155384 TCCACATTGTTGCAAGTGACAGG - Intronic
1175656951 20:60779285-60779307 TCAACACTGCTGGCCTTGACTGG - Intergenic
1176032214 20:63018042-63018064 TCCACACAGCGGCCCCGGACTGG + Intergenic
1177501358 21:21960200-21960222 TCCACACTGCTGCAATTGACAGG + Intergenic
1181736104 22:24882812-24882834 TCCATGCTGCTGCGCATGACAGG + Intronic
1182447507 22:30398094-30398116 TCCCCACTGCTGCCAGTGGCAGG - Intronic
1183411878 22:37659532-37659554 ACCACACTGCTGCGCCTCACAGG - Intronic
1183955323 22:41376755-41376777 TCCACACTGCACACCGTGCCAGG + Intronic
1184584807 22:45440761-45440783 ACCACACTCCTACCCCTGACAGG + Intergenic
1184968840 22:48000797-48000819 TCCACATTGCTGCAAATGACAGG + Intergenic
1185199144 22:49491351-49491373 TCCTCTCTGCCGCCCGGGACTGG + Intronic
1185249640 22:49793938-49793960 CCAACGCTGCTGCCCGTGTCTGG + Intronic
949420765 3:3863316-3863338 TCCACTCTGCAGGCTGTGACTGG + Intronic
952941478 3:38448079-38448101 TCCACGATGCTGCCAATGACAGG - Intergenic
953121879 3:40052342-40052364 TCCATGTTGCTGCCGGTGACAGG + Intronic
953325292 3:42007748-42007770 TCCACACTGCTGGCTGTGGAGGG - Intergenic
953904404 3:46861232-46861254 TCCTCACTGCTACCCCTGCCAGG - Intronic
954640797 3:52096666-52096688 TCCACACTCCTGCCTCTGCCTGG + Exonic
961221492 3:125204415-125204437 TCCACGTTGCTGCACATGACAGG - Intronic
963089487 3:141469623-141469645 TCCATGCTGCTGCAAGTGACAGG + Intergenic
968739813 4:2321832-2321854 GCCACGCTGCTGCCCGGCACAGG - Intronic
969682676 4:8652040-8652062 TCCACTCTGATGCCCGTGCTGGG + Intergenic
974147858 4:57968297-57968319 TCCACACTGCAGAAGGTGACAGG - Intergenic
981245256 4:142528969-142528991 TAGACACTGCTGCCAGTTACAGG - Intronic
981465309 4:145062850-145062872 TCCACGCTGCTGCAAATGACAGG - Intronic
982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG + Intergenic
985345759 4:189002389-189002411 TCCACCCTGGTGCCAGTGGCTGG + Intergenic
986913199 5:12583509-12583531 TCCACACTGTTGCAAATGACAGG + Intergenic
987260189 5:16195345-16195367 TCCACCCTGTTGCCAGTGGCTGG - Intergenic
993243135 5:85415896-85415918 GCAACACTGCTACCAGTGACTGG + Intergenic
994053375 5:95387879-95387901 TCCACATTGCTGCAAATGACAGG - Intergenic
995537846 5:113155189-113155211 TCCACACTGCTGCAAATGACAGG + Intronic
996905858 5:128598818-128598840 TCCACATTGCTGCAGATGACAGG + Intronic
997575752 5:134975958-134975980 TCCACATTGCTGCAAATGACAGG - Intronic
1002564024 5:180100043-180100065 TCCACACTGCTTGCCGTCCCTGG + Intergenic
1003572392 6:7264282-7264304 TCCACCCTGCTGCCCACCACAGG + Intergenic
1009673593 6:66788177-66788199 TCCACTCTGCTGACCATGGCAGG + Intergenic
1011522852 6:88228752-88228774 TCCATACTGCTGCCTGGGACTGG - Intergenic
1012002524 6:93670873-93670895 GCCACTCTGCTGCCTCTGACAGG - Intergenic
1012256524 6:97039220-97039242 TCCACATTGCTGCAAATGACAGG - Intronic
1014712888 6:124829197-124829219 TCCACATTGCTGCAAATGACAGG - Intergenic
1018965498 6:168484783-168484805 TCCACATTGCTGCCTGTGTCAGG - Intronic
1019167896 6:170110976-170110998 CCCACCCTGCTGCCCGGTACAGG + Intergenic
1019529365 7:1495861-1495883 TCCCCACTCCCGCCCGTGGCTGG + Intronic
1021851022 7:24808759-24808781 CCTACTCTGTTGCCCGTGACTGG + Intronic
1023196205 7:37642142-37642164 TCCAGACTGCTGCCACTGGCTGG + Intergenic
1024961881 7:54985235-54985257 TCCATATTGCTGCACATGACAGG + Intergenic
1026190624 7:68122936-68122958 TCCACTCCCCTGCCAGTGACAGG + Intergenic
1027460589 7:78448074-78448096 TCCACATTGCTGCAAATGACAGG + Intronic
1028870732 7:95769330-95769352 TCCACACTGTAGCATGTGACAGG + Intergenic
1032127111 7:129203277-129203299 GCCACACTGCAGCCCATCACTGG - Intronic
1034099851 7:148441530-148441552 TCCATGCTGCTGCAAGTGACAGG - Intergenic
1034109245 7:148520542-148520564 TCCACATTGCTGCAAATGACAGG + Intergenic
1035691750 8:1563698-1563720 TCCACATTGCAGCCCAGGACAGG - Intronic
1037242826 8:16796860-16796882 TCCACATTGCTGCAAATGACAGG + Intergenic
1037858461 8:22388349-22388371 TCCACACTCCTCCCCGCCACAGG - Intronic
1037912132 8:22749745-22749767 TCCACACTGCTGCCCGTGACTGG - Intronic
1038257437 8:25963116-25963138 TCCAAACTGATGCCCTTGAAAGG - Intronic
1045271102 8:100662335-100662357 TCCCTACTCCTGCCCCTGACAGG - Intronic
1045944792 8:107783386-107783408 CTCACACTGCTACCCGAGACTGG - Intergenic
1047222119 8:122927057-122927079 ACCACAATGCTGCCCATCACAGG + Intronic
1047303194 8:123632665-123632687 TCCACACTGCTTCTCTGGACCGG + Intergenic
1048611315 8:136026149-136026171 TCCACTCCACTGCCCTTGACAGG + Intergenic
1050047839 9:1566560-1566582 TCCACATTGCTGCAAATGACTGG + Intergenic
1050063276 9:1732836-1732858 TGCACACTGTTGCCCATGAGTGG + Intergenic
1052850839 9:33377530-33377552 TTCACACGGATGCGCGTGACAGG - Intergenic
1056957348 9:91092713-91092735 TCCACAGAGCTGCCAATGACTGG - Intergenic
1057126484 9:92619796-92619818 CCCACACTGCTTGCCGTGAGAGG - Exonic
1057168920 9:92949206-92949228 TCCACACTGCTCCCCTTTCCAGG - Intronic
1057955625 9:99405283-99405305 TCCACATTGCTGCAAATGACAGG + Intergenic
1060974812 9:127758649-127758671 TCCACACTCCTGCCTCTGCCAGG + Intronic
1061801522 9:133115622-133115644 CCCCCACTGTTGCCTGTGACAGG - Intronic
1062091658 9:134681560-134681582 TCCACTCTGGAGCCAGTGACAGG - Intronic
1062392402 9:136339090-136339112 TCCTCTCTGCTGCCTGTGAAAGG - Intronic
1062713113 9:137987431-137987453 CCCACAGTCCTGCCCATGACTGG + Intronic
1188539703 X:31235992-31236014 TCCACACAGCTTCCCCTGGCTGG - Intronic
1190600707 X:52089348-52089370 ACAACACTGCTACCAGTGACTGG + Intergenic
1191993786 X:67068247-67068269 ACAACACTGCTGCCAGTGGCTGG - Intergenic
1195145111 X:102006285-102006307 TCCACACTGCTGCAAAGGACAGG - Intergenic
1197542548 X:127783222-127783244 TCCACATTGCTGCAAATGACTGG + Intergenic