ID: 1037912671

View in Genome Browser
Species Human (GRCh38)
Location 8:22753267-22753289
Sequence CTCCCTCCTGACTCCTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 8, 3: 32, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037912671_1037912672 3 Left 1037912671 8:22753267-22753289 CCTGCTCAGGAGTCAGGAGGGAG 0: 1
1: 0
2: 8
3: 32
4: 304
Right 1037912672 8:22753293-22753315 TGAGCATCCCAGAGACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037912671 Original CRISPR CTCCCTCCTGACTCCTGAGC AGG (reversed) Intronic
900152021 1:1182931-1182953 CTTCCTCCTGGTTCCGGAGCAGG - Exonic
900316524 1:2059946-2059968 GTCCCTGCTGGCCCCTGAGCTGG + Intronic
900601537 1:3504831-3504853 CTCCCTCCTCACATGTGAGCCGG - Intronic
900647988 1:3717666-3717688 CTTCCTCCTGTCTCCCCAGCAGG - Intronic
901462664 1:9400873-9400895 CACCCTCCTCAGGCCTGAGCCGG - Intergenic
902216863 1:14939835-14939857 CTCCCTTCTGCCTCCAGAGGAGG - Intronic
903127837 1:21259785-21259807 ATACCTGCTTACTCCTGAGCAGG - Intronic
904497834 1:30897187-30897209 CTGTCTCCTGACTCCTGGGCAGG - Intronic
904618126 1:31760843-31760865 CTCCATCCTGCCTCCGGAGCTGG + Intronic
904982380 1:34517489-34517511 CTCACCCCTGACCCCTGAACAGG - Intergenic
905115195 1:35632862-35632884 CTCACTCCTGTCGCCTGGGCTGG - Intronic
905381226 1:37562795-37562817 CTCCCTCCTATCACCTCAGCTGG - Intronic
905773480 1:40653444-40653466 CTCCCTCCTGCATCCTGAGCTGG - Intronic
905880392 1:41459621-41459643 CTCCCTACTTCCTCCTGAGCTGG - Intergenic
906286088 1:44588755-44588777 CACCCTCCTCACACCTGTGCTGG - Intronic
906398055 1:45484136-45484158 CTCCCTCTTGTCGCCTAAGCTGG + Intronic
907482605 1:54755076-54755098 CCCCTTCCTGACACCTGAGGCGG - Intergenic
907517592 1:55002428-55002450 CTCACTCCTGCCTGCTGTGCTGG + Intronic
908389146 1:63669609-63669631 CTTCCTCCTGACTGCAGGGCAGG + Intergenic
910846609 1:91610434-91610456 CTCCCTACTGACTCTGGGGCTGG + Intergenic
912944747 1:114075592-114075614 CTGCCTCCTGACTCCTTGGGGGG + Intergenic
915355925 1:155255190-155255212 CCCCCTCCTCACTCCTGGACCGG - Exonic
915524190 1:156466138-156466160 CTCCCTGCTGCCTCCTCAGTGGG - Exonic
916834613 1:168531006-168531028 CTTCCTCCTGCCTCCTCAGCTGG - Intergenic
917821509 1:178768649-178768671 CTCCCTCCTCAGTCCTGGGGAGG + Intronic
918467714 1:184838396-184838418 CTCTTTCCTCACTCCTGATCTGG - Intronic
919512403 1:198481648-198481670 CTCCCACCTACCTCCTGACCAGG + Intergenic
919826270 1:201505777-201505799 CTGCCTCCTGACTCTCCAGCTGG - Intronic
919990336 1:202704852-202704874 CTCCCTCCTTGCTTCAGAGCAGG + Intronic
920387356 1:205578443-205578465 CTCCCCCATGAGTTCTGAGCTGG + Intronic
920432530 1:205928049-205928071 CTCCTTCCTGGCTCCTCGGCAGG - Exonic
920447317 1:206028519-206028541 AGCCCTCCTGACTTCTAAGCGGG + Intergenic
920502819 1:206496256-206496278 CTCCCTCCTGGCTGCTGGCCAGG + Exonic
920701662 1:208222537-208222559 CTGCCTCCTGAATCCTGATCGGG - Intronic
921448938 1:215279788-215279810 CTCCACACTGACTGCTGAGCTGG - Intergenic
923985557 1:239377773-239377795 CTGCCTCCTGCCTCCTTAGTCGG - Intergenic
924795849 1:247291695-247291717 CTCCCTCCTGTCTCCTCAGAGGG - Intergenic
1063603014 10:7498989-7499011 CTCCCTGTTGACTCCTGCCCTGG + Intergenic
1064030067 10:11877838-11877860 GTCCCTGCTGCCCCCTGAGCTGG - Intergenic
1064183957 10:13144092-13144114 CTTCCTCCTGTCACCTGAGAGGG + Intergenic
1064719399 10:18213779-18213801 CTCTGTCCTGACTCCAGAGATGG - Intronic
1065511191 10:26480041-26480063 CACCCTCCCAAATCCTGAGCTGG + Intronic
1067557919 10:47285333-47285355 TACCCTCCTGACTCATGATCGGG + Intergenic
1069897266 10:71687489-71687511 CTCCCTGCTGACACCTCACCTGG + Intronic
1070731762 10:78833683-78833705 CTCCCTCCTGCCCCTTGACCCGG + Intergenic
1072735102 10:97873846-97873868 CTCCCTCCTCACAGCTGAACAGG + Intronic
1072788288 10:98299587-98299609 CTCCCTCCAGCCTCCAGAGGTGG - Intergenic
1073059365 10:100724310-100724332 CTCCCTCCTGCCCACTGCGCGGG + Intergenic
1073096978 10:100985764-100985786 TTCCATCCTGACTCCTTGGCAGG + Intronic
1073155088 10:101339979-101340001 CTCCCTGCTGATTCCAGTGCTGG - Intergenic
1073214319 10:101828258-101828280 CTCCCTCCTGCCTCCTTCCCAGG - Exonic
1075901117 10:126043490-126043512 GTCCCTCCTCACTGCTGAGGGGG - Intronic
1076202803 10:128571720-128571742 CTGCCTCCTGACTGCTGATTGGG + Intergenic
1076281981 10:129254123-129254145 CTCTCTGCTGATTCCTAAGCAGG + Intergenic
1076298249 10:129404010-129404032 CTCCCTCCAGAATGCTGAGATGG - Intergenic
1076788510 10:132764082-132764104 CTGCCTCCTGCCTCCTAAGAGGG - Intronic
1077094453 11:793365-793387 CTCCCTCCTTTCCCCTGACCAGG - Intronic
1077721764 11:4637254-4637276 CTCCCTCTAGTCTCTTGAGCTGG + Intergenic
1079324129 11:19476964-19476986 CTCCCACCTGACACCTGAGGGGG - Intronic
1080017076 11:27518881-27518903 CTCCCTCCTACTTCCTGAACAGG - Intergenic
1083756145 11:64792604-64792626 CTCCCTCCTGGCTTCAGGGCTGG - Intronic
1083860741 11:65418679-65418701 CCCTCTCCTGCCTCCTGACCTGG + Intergenic
1084112938 11:67025053-67025075 CACCATGCTGACTCCTGAACAGG - Intronic
1084169585 11:67394277-67394299 CTCCCTCCAGCCTCCTGCCCTGG - Intronic
1084516198 11:69639185-69639207 CTCCCTCCTGGACCCAGAGCCGG + Intergenic
1084568345 11:69944279-69944301 CACCCTGCAGGCTCCTGAGCAGG - Intergenic
1084639013 11:70413355-70413377 CTCCCTCCTCACAGCAGAGCCGG - Intronic
1085782172 11:79419441-79419463 TTCCCTCCTGACTCATCAGAAGG + Intronic
1086405474 11:86495735-86495757 TAACCTCCTGTCTCCTGAGCTGG + Intronic
1088828692 11:113517006-113517028 CTGCCTCCTGATTCCTGGCCTGG + Intergenic
1089152680 11:116376161-116376183 CTCCCTCATGAATCCTGTTCTGG + Intergenic
1089304236 11:117516739-117516761 CTCTCTTCTGACTCCTGCCCAGG - Exonic
1089514021 11:119020165-119020187 CTCCCAGCTGTCTCCTGAACAGG + Exonic
1091295132 11:134468451-134468473 TTCTCTGATGACTCCTGAGCAGG + Intergenic
1091714754 12:2768802-2768824 CTCCCTCCTCACTCCATATCTGG + Intergenic
1093006274 12:14054509-14054531 CTCCCTTCTGACTCCTGAACAGG - Intergenic
1093726760 12:22521917-22521939 ACCCCTCCTGACTACTGAACTGG + Intronic
1094365407 12:29674639-29674661 CTCCCTCCCTCCTCCTGAGCTGG - Intronic
1096373642 12:51089452-51089474 CTCTCGCCTGTCTCCTGAGTAGG - Intergenic
1096585646 12:52618020-52618042 CTCCCTCCTGAGTCCTTAAAAGG + Intronic
1098464001 12:70765721-70765743 CTGACCCCTGACCCCTGAGCAGG + Intronic
1102021348 12:109685620-109685642 CTCCATGCTGAATCCTGAGAGGG + Intergenic
1103454044 12:121050771-121050793 CTCCTTCCTGACTCTAAAGCAGG + Intergenic
1105281399 13:18964799-18964821 CTACCTGCTGGCTCCTGTGCGGG + Intergenic
1105971109 13:25429864-25429886 CACCCTGCTGACTCCTGCCCAGG - Intronic
1106177333 13:27342536-27342558 CTCCCTCCAGTCTTCAGAGCTGG + Intergenic
1109794109 13:67287509-67287531 GTCCTACCTGTCTCCTGAGCTGG + Intergenic
1111952107 13:94716932-94716954 TTTCCTCATGTCTCCTGAGCAGG + Intergenic
1115750765 14:36487411-36487433 CTCCCTCTTGTCACCTGGGCTGG - Intronic
1117061320 14:51966615-51966637 CCCCCTCCTGACCCCTGTTCCGG + Exonic
1117084482 14:52185313-52185335 CTCCCTCATGACTAATGATCTGG - Intergenic
1117727913 14:58692471-58692493 CTTCCTCCTGACTCCTGCATGGG - Intergenic
1118245178 14:64103552-64103574 CTCACTCCTGCCTCCTGTCCAGG + Intronic
1119344241 14:73909085-73909107 CTCCCTCCTGGCCCAAGAGCTGG - Intronic
1119853180 14:77880603-77880625 CTCCCTCCTCACTCCTTGTCTGG - Intronic
1120120983 14:80680069-80680091 CTCCCACCTAGCTCCAGAGCAGG - Intronic
1121661254 14:95636782-95636804 ATCCCTGCAGAATCCTGAGCAGG + Intergenic
1121819000 14:96950946-96950968 CACTCTGGTGACTCCTGAGCAGG - Intergenic
1122201012 14:100122704-100122726 TTCCCTAGTGACACCTGAGCTGG + Intronic
1122354468 14:101114704-101114726 AGCCCTCCTGACTACTGGGCAGG + Intergenic
1122417755 14:101558396-101558418 CTCCCTCCTGACCACTGGGATGG + Intergenic
1122651324 14:103228714-103228736 CTCTCTCCTGACTCCTGCAGTGG - Intergenic
1123943277 15:25226899-25226921 CTCCCTCCTGTCTCCCCAGATGG + Intergenic
1124504941 15:30264515-30264537 CTGCCTCCTGCCTCCTCTGCAGG - Intergenic
1124738611 15:32274120-32274142 CTGCCTCCTGCCTCCTCTGCAGG + Intergenic
1125037950 15:35149010-35149032 CCCCCTCCTGAATCCTGCTCAGG + Intergenic
1125485716 15:40109342-40109364 CTCCCTCCCGCCTGCCGAGCAGG + Intergenic
1125534919 15:40437245-40437267 GCTCCTCCTGACTCTTGAGCTGG - Intergenic
1126781539 15:52143244-52143266 GTCCTCCCTGACCCCTGAGCTGG + Intronic
1127363253 15:58263546-58263568 CTGCCTTCTGACTGCTGAGAAGG + Intronic
1127701341 15:61504476-61504498 CTCCCTCCCCAGCCCTGAGCGGG - Intergenic
1127993929 15:64141481-64141503 CTCCCTCCTGGGTCCCCAGCTGG - Intronic
1128611414 15:69076594-69076616 CTGATTCCTGATTCCTGAGCAGG + Intergenic
1128735599 15:70052236-70052258 AGGCCTCCTGACCCCTGAGCTGG - Intronic
1128761706 15:70220682-70220704 CTCCCTCCTGCCTCCTGCCATGG + Intergenic
1128867496 15:71125675-71125697 CCCCCTCCTGACTGGAGAGCTGG - Intronic
1129171379 15:73810223-73810245 CTCCCTTCTGACCCCAGAGCAGG - Intergenic
1129530672 15:76261718-76261740 CTCCCTCCTCACTCGTGGGCCGG - Intronic
1129923819 15:79344222-79344244 CTCACTCCTCACTCCTGAAAAGG - Intronic
1131263729 15:90903411-90903433 CGTCCTCCTTCCTCCTGAGCAGG + Exonic
1132645854 16:998956-998978 CTCCCTCCTCAGTCCTGGCCAGG - Intergenic
1132733865 16:1376127-1376149 CTCCCTCCTCCCTCCAGGGCTGG + Intronic
1132733897 16:1376225-1376247 CTCCCTCCTCCCTCCAGGGCTGG + Intronic
1132733921 16:1376297-1376319 CTCCCTCCTCCCTCCAGGGCTGG + Intronic
1132988907 16:2783136-2783158 CTCCCTTCTGCCTCCTTAGCTGG + Intergenic
1133119772 16:3598854-3598876 TTCCCTCCTCACTCCCCAGCAGG + Intronic
1135798047 16:25464517-25464539 CTCCATCCTGGCTTCTGAACTGG + Intergenic
1136343344 16:29659629-29659651 CTACCTCCTGCCTCCAGAGGCGG - Intergenic
1137485956 16:48891209-48891231 CTACCTCTTTAATCCTGAGCAGG + Intergenic
1141205706 16:81931761-81931783 CTCCTTCCTGAATTCTGAGTAGG - Intronic
1141656836 16:85421199-85421221 CACCCTCCTGTCTCCTGGACGGG + Intergenic
1142157161 16:88537809-88537831 CTCCCTCCACACTCCTGGGGTGG + Intergenic
1142280907 16:89147117-89147139 CTCCCTCCTCCCTCCTGCTCCGG - Intronic
1142344333 16:89544556-89544578 CTCCCTCCTGTGTCCTGAAGGGG + Intronic
1142360008 16:89621456-89621478 CTCTCTTCTGGCTCCTGACCAGG - Intronic
1143658335 17:8310428-8310450 CCACCACCTGTCTCCTGAGCCGG - Intronic
1144300094 17:13915356-13915378 CTCCATCCTGATTCCTGATCAGG - Intergenic
1144823412 17:18091149-18091171 CTGCTTCCTGCCTCATGAGCAGG - Intronic
1145247440 17:21278826-21278848 CTGCCTCCTGCCTGCTGGGCAGG + Intergenic
1145267671 17:21388277-21388299 CTCGCTTCAGACGCCTGAGCGGG + Intronic
1147931137 17:43982280-43982302 CTCACTCCAGACTTCTGAGGTGG - Intronic
1150266016 17:63832895-63832917 CTCCCTCCAGGCTCCAGGGCTGG + Exonic
1151969225 17:77449395-77449417 CTGCCTCTGGATTCCTGAGCTGG - Intronic
1152069904 17:78129189-78129211 CCCACTCCTGACACCTGGGCGGG + Intronic
1152336576 17:79702522-79702544 CTCCCTCCTGACCCCAGTGCTGG - Intergenic
1156674664 18:39513347-39513369 CTGCCTCCTGACTTTTGAACTGG - Intergenic
1156786289 18:40919457-40919479 CTCCCTCTTGACTCTTAGGCTGG + Intergenic
1157299575 18:46469760-46469782 CTCCCTGCAGAGTGCTGAGCTGG + Intergenic
1157504363 18:48216279-48216301 CTTCCTCCTTACTGGTGAGCTGG - Intronic
1159932833 18:74332208-74332230 CTCTCTGCTGAGTCCTGAGGTGG + Intronic
1160225361 18:77007464-77007486 CTCCCTCCAGCCCCCTGAGCAGG - Intronic
1161315175 19:3614319-3614341 CCCCCTCCTGAGTCCTGGGTGGG - Intronic
1161579916 19:5075133-5075155 CGTCCTCCTGCCTCCTGGGCCGG + Intronic
1161741669 19:6024689-6024711 TTCCATCCTGACTTCTGTGCTGG - Intronic
1163027415 19:14520325-14520347 CATCCTCCTGCCTCCTGAGGCGG + Intronic
1164694232 19:30231604-30231626 CTCCCTTCCAACTCCCGAGCAGG - Intronic
1164821443 19:31254340-31254362 CTCACTCCTGCCTCCTCTGCAGG - Intergenic
1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG + Intronic
1164982930 19:32627879-32627901 CACCCTGCTGCCTCCTGCGCTGG - Intronic
1165069814 19:33248788-33248810 GTCCCTCCTGGCTCCTGAGAAGG - Intergenic
1165351829 19:35279837-35279859 CCCCCTCCCCACTCCTGAGATGG - Intergenic
1165636694 19:37346411-37346433 TTCCCTCCTTAGGCCTGAGCAGG + Intronic
1166716144 19:44968999-44969021 CTCCCTGCTGAGCCCTGATCAGG - Intronic
1166750031 19:45160178-45160200 CTCCCTCCTGCCTCAGGAGCAGG - Intronic
1166816670 19:45550510-45550532 CTCCCTCCTCACTCTGCAGCTGG + Intronic
925851611 2:8087599-8087621 CTCTCTCCTGACTGCTATGCTGG - Intergenic
925931882 2:8714617-8714639 CTCCTTCCTGCCTGCTGAGCTGG - Intergenic
926117337 2:10221750-10221772 CTCCATCCTGACAGCTGAGCAGG - Intergenic
926540815 2:14178871-14178893 CAACCTCCTGACTCCTGCTCGGG + Intergenic
926795549 2:16616205-16616227 CCTCCTCCTGACTCCAGGGCTGG + Intronic
927521803 2:23703524-23703546 CCCTCTCCAGACACCTGAGCTGG - Intronic
927854365 2:26518716-26518738 CTCTTTAGTGACTCCTGAGCTGG + Intronic
928309511 2:30197791-30197813 CTCCCGCCTGAGTCTTGAGGGGG - Intergenic
931648306 2:64445502-64445524 CTTCCTCCATCCTCCTGAGCAGG - Intergenic
931950549 2:67356767-67356789 CTGACCCCTGACCCCTGAGCAGG + Intergenic
934526766 2:95056873-95056895 GTCCCTCCTGGCGCCTGACCGGG - Intergenic
934615752 2:95769608-95769630 CTCCAGCCTGTCCCCTGAGCTGG + Intergenic
934645140 2:96054949-96054971 CTCCAGCCTGTCCCCTGAGCTGG - Intergenic
934838544 2:97611038-97611060 CTCCAGCCTGTCCCCTGAGCTGG - Intergenic
936457806 2:112688736-112688758 CTCCCTCTTCACTCCAGGGCAGG - Intergenic
937499645 2:122463992-122464014 CTCCCTGCTGTCTCTTGACCAGG - Intergenic
938169219 2:129059885-129059907 CTGCCTCCAGTCTCCTGTGCTGG + Intergenic
940987202 2:160062056-160062078 CACCCTCCTGGCTCCTGCGGGGG - Intronic
942245000 2:173999530-173999552 CTCCCTCCTAGCTCAGGAGCCGG - Intergenic
944952229 2:204764853-204764875 TTCCCTCCTCCCTCCTGCGCTGG + Intronic
945995328 2:216431627-216431649 CTCCCTTCTTACTGCTGAGGGGG + Intronic
946325146 2:218981207-218981229 CTCCTTCCTGGGACCTGAGCAGG - Exonic
946896084 2:224326003-224326025 TTCCCTCCTGAATCCTGGGCTGG + Intergenic
947134519 2:226963914-226963936 TTCCTTCCTGACAACTGAGCAGG + Intronic
947632971 2:231665705-231665727 ATCCCACCCCACTCCTGAGCAGG + Intergenic
949009448 2:241670252-241670274 CTGTCTCCTGGCTCCTCAGCAGG + Intronic
1169201612 20:3712908-3712930 CTCCTCCCTGACACCTGAGAGGG + Intergenic
1169511263 20:6266739-6266761 ATGCCTCCTGACTGCAGAGCTGG + Intergenic
1169835381 20:9872339-9872361 TTCTCTCCTGAATCCTGGGCAGG - Intergenic
1170793600 20:19527560-19527582 CTCTCTCCTGCCTCATGAGCAGG - Intronic
1172132114 20:32662707-32662729 TTCCTTCCTGACTGCTGAGATGG - Intergenic
1172223841 20:33291224-33291246 TCCCCTCCTGATTCCTGATCTGG + Intronic
1172414636 20:34754832-34754854 CTCCCACCTGGCTTCTCAGCAGG - Exonic
1173737694 20:45373465-45373487 CTGCCTCGTGACTTCTGAGCAGG + Exonic
1173816932 20:45995568-45995590 ATCCCTGCTGAGTGCTGAGCTGG - Intergenic
1173854977 20:46244406-46244428 CTCCCTCTTCACTCTGGAGCCGG - Intronic
1175742201 20:61427607-61427629 CTCCTTCCAGTTTCCTGAGCAGG + Intronic
1175806425 20:61831700-61831722 GTCCCTCCAGGCTCCTGGGCGGG + Intronic
1178367137 21:31997379-31997401 CTCCCTCGTGACTTTTGATCTGG - Intronic
1178719182 21:34992929-34992951 CTCCCTGCTGAGGCCTGGGCGGG - Intronic
1179077471 21:38136433-38136455 CTCCCTCCTATCTACTAAGCAGG + Intronic
1179336491 21:40461532-40461554 CTCCCCCCAGACCCCAGAGCTGG - Intronic
1179454636 21:41490742-41490764 CTCCCTCCTGGCCCATGAGCTGG - Intronic
1179484373 21:41700320-41700342 ATGCCTCCTGTCTGCTGAGCTGG - Intergenic
1179794799 21:43776518-43776540 CTCCCTCCCGACACCAGCGCTGG - Intergenic
1180837037 22:18935045-18935067 CGCCCTCCTGTCTCCTTGGCCGG + Intronic
1181064921 22:20300980-20301002 CGCCCTCCTGTCTCCTTGGCCGG - Intergenic
1181453436 22:23038882-23038904 CTCCCTCCTGACACCTGCACAGG + Intergenic
1181504825 22:23346093-23346115 CTCCCACCTGACTGCTGAGCTGG - Intergenic
1181655936 22:24298695-24298717 CTCCCACCTGACTGCTGAGCTGG - Intronic
1181709813 22:24676337-24676359 CTCCCACCTGACTGCTGAGCTGG - Intergenic
1183606166 22:38867757-38867779 CTCCAGCCTGTCTCCTCAGCTGG + Intronic
1184343941 22:43901551-43901573 CTCCTTCCTCAATCCTGACCCGG + Intergenic
1184460105 22:44633126-44633148 GGCCCTCCAGACTCCTTAGCTGG + Intergenic
1184649042 22:45911275-45911297 CTCCCTCCTGGCTCCAGGGGAGG - Intergenic
1184902188 22:47453332-47453354 CTTCCTGCTGACACCTGAGTGGG + Intergenic
1203287130 22_KI270734v1_random:160344-160366 CGCCCTCCTGTCTCCTTGGCCGG + Intergenic
949918277 3:8981831-8981853 CTCTCTCCTGACCCCTGGCCTGG + Exonic
950018096 3:9768354-9768376 CTCCCTCCTGACTCCCCATCTGG + Intronic
950440212 3:13006170-13006192 CCCCCTCCTCCCACCTGAGCTGG + Intronic
950499001 3:13352341-13352363 CTCCCTTCAGCCTCCTGAGGTGG + Intronic
951301072 3:20997164-20997186 CTCTCACCTCTCTCCTGAGCTGG - Intergenic
952121389 3:30248999-30249021 CTCCCCTCAGCCTCCTGAGCAGG - Intergenic
952409020 3:33030890-33030912 TTCCCTACTGATTCCTGAGAGGG - Intronic
953911481 3:46895412-46895434 CCCACTCCTGACTCCTGGGTGGG + Intronic
954626335 3:52023917-52023939 CTCCCTCCTGAGGCCTGAGCTGG - Intergenic
956723746 3:72140021-72140043 CTATCTCCTGACTCCTCAGATGG - Intergenic
957147189 3:76439936-76439958 CTCTCTCCTTAAGCCTGAGCAGG + Intronic
960572980 3:119203642-119203664 CTCACTCCTCACCCCTCAGCAGG - Intronic
961244701 3:125441044-125441066 CTCCTTCCTGACTACTGAGCAGG + Intergenic
961470203 3:127106606-127106628 TTCTCTCCTGTCTCCTGGGCAGG - Intergenic
962259949 3:133895846-133895868 CTCCCGCCTGCCTCCTCCGCCGG + Intergenic
963244744 3:143047758-143047780 CTCCCACCTCCCTCCTGAACGGG + Intronic
963246351 3:143067374-143067396 CTCCCCTGTGACTCTTGAGCTGG + Intergenic
966847940 3:184144978-184145000 TGCCCTCCTGGCTCCTGGGCTGG + Exonic
967791595 3:193555190-193555212 CCCGCTCCTCACTCCTGAGAAGG - Intronic
968395985 4:239098-239120 CTCCCTCCAGATTCCTGGGTGGG + Intergenic
968414976 4:423978-424000 CTCCCTCCAGATTCCTGGGTGGG + Intergenic
968905629 4:3449409-3449431 CTCCCTCCTGACCCTCCAGCGGG + Exonic
969315910 4:6381206-6381228 CTCCCTGCTGCCTCCTGCCCAGG - Intronic
970192249 4:13528045-13528067 GTCCCGGCTGACCCCTGAGCGGG - Intergenic
971359320 4:25922355-25922377 CACCATCCTTCCTCCTGAGCTGG - Intronic
978312267 4:107397402-107397424 CTCCTCCCTGACCCCAGAGCAGG - Intergenic
984364963 4:178786455-178786477 CTGCCTCCTGTCACCTCAGCTGG - Intergenic
985131826 4:186746256-186746278 CTCTGTCCTTACTCCGGAGCTGG - Intergenic
985562787 5:599862-599884 CGCCATTCTGACTGCTGAGCTGG + Intergenic
985775809 5:1841168-1841190 CCCCCTCCTGTCCCCTGAGGAGG - Intergenic
988039636 5:25873095-25873117 CTCCTGCCTGTCTCCTGAGCTGG + Intergenic
990972570 5:61525111-61525133 CTGCCTCCTGACTCCTGGGCAGG - Intronic
992672536 5:79074620-79074642 CTCGCTCCTGACACCTGGGTGGG + Intronic
997379227 5:133423458-133423480 CTCCCTCCTGGAACCTCAGCGGG + Intronic
998137900 5:139684057-139684079 TTCCCTCCTGTCTGCTGGGCTGG - Intergenic
998551553 5:143082376-143082398 ATTCCTCATGACTTCTGAGCAGG - Intronic
999240199 5:150123028-150123050 CTCCCTCCTGGTACCTGGGCAGG + Exonic
1000404636 5:160874221-160874243 CTGACCCCTGACCCCTGAGCAGG + Intergenic
1001087628 5:168712523-168712545 CTCCATCCTTGCTGCTGAGCTGG - Intronic
1002061466 5:176628289-176628311 CTCCCTCCTGCCTCCTCCCCAGG - Intronic
1002089580 5:176796641-176796663 CTCCCTCCTGAACCCTCCGCTGG + Intergenic
1002304092 5:178273300-178273322 AGGCCTCCTGCCTCCTGAGCTGG + Intronic
1003557982 6:7157833-7157855 ATCCCTCCTGACTCCAGAAGAGG + Intronic
1004143583 6:13044550-13044572 CTCCGTCCTGACGCCAGAGGTGG - Intronic
1005083586 6:21981320-21981342 CTGCCTCCTCCTTCCTGAGCTGG + Intergenic
1006298045 6:33178787-33178809 CTCCCTACTGCACCCTGAGCTGG + Intronic
1006987528 6:38185993-38186015 CTCACTCCTGCCTCCTAAACTGG + Intronic
1013216668 6:108033641-108033663 TTCCTGCCTGACTTCTGAGCTGG + Intergenic
1013463749 6:110399735-110399757 CTCCCTCCTGACCCCGGTGTGGG - Intronic
1013803389 6:113971158-113971180 CTCCCTGCGGCCTCCTGAGGTGG - Exonic
1014364531 6:120523034-120523056 CTGACCCCTGACCCCTGAGCAGG + Intergenic
1014776220 6:125512802-125512824 CTCCCTCTTGAGTCCCTAGCAGG - Intergenic
1015127329 6:129769238-129769260 GTACATCCTGACTCCAGAGCAGG + Intergenic
1015338655 6:132071826-132071848 CTCTCTCCTGCCTCCTGTCCTGG + Intergenic
1019278836 7:190315-190337 CTGTCTCCTCACTCCTCAGCGGG + Intergenic
1019350755 7:552885-552907 CTCCCTCCTGACCCCCGACACGG + Intronic
1020061459 7:5155658-5155680 CTCCATCCTGCTTCCTGAGAAGG - Intergenic
1020114244 7:5466752-5466774 CTCCCTCCTGCCTCCTGCCCAGG - Intronic
1020159288 7:5756177-5756199 CTCCATCCTGCCTCCTGAGAAGG + Intronic
1020166697 7:5812998-5813020 CTCCATCCTGCTTCCTGAGAAGG + Intergenic
1021311867 7:19106833-19106855 GTCCCTCCCCTCTCCTGAGCTGG + Intronic
1022399144 7:30019700-30019722 CTCCCAACAGACTCCTGAGGAGG - Intronic
1022489241 7:30804030-30804052 TTCCCTCATGACTCTTGGGCTGG + Intronic
1022607896 7:31834417-31834439 CTCCCTCCTGACTGCTTTCCTGG - Intronic
1022902520 7:34825033-34825055 CCACCTCCTGCCTCCTGAGGTGG + Intronic
1023271232 7:38464984-38465006 TTACCTCCTGACTCTTGATCTGG - Intronic
1023381116 7:39609653-39609675 CAACCTCCGGACTCCTCAGCGGG - Intronic
1023726117 7:43143848-43143870 TTCCCTCTAGACTTCTGAGCTGG - Intronic
1024294492 7:47831634-47831656 CTCCTGCCCGACTGCTGAGCTGG + Intronic
1024547181 7:50531871-50531893 TCCCCTCCTACCTCCTGAGCAGG - Intronic
1024978353 7:55134115-55134137 CTGAGTCCTGACTCCTGAGCAGG - Intronic
1029445070 7:100607403-100607425 CTCCCTCCTACCTGCTGAGCAGG + Intronic
1030106271 7:105989920-105989942 GTGACTCCTGACTCCTGAGTTGG - Intronic
1030739078 7:113086639-113086661 CCCCTACCTGACTCCAGAGCTGG + Intronic
1031008590 7:116500241-116500263 CTGCGTCCTGTCTCCTCAGCTGG + Exonic
1031919745 7:127591827-127591849 CTCCCTCCTTATTCTTGGGCTGG + Intronic
1032537656 7:132678141-132678163 CTCCCTGCTGCCTCCTGGTCAGG + Intronic
1032543170 7:132721167-132721189 CTCCTTCCTTTCTTCTGAGCTGG - Intronic
1034512507 7:151547776-151547798 CCCCCTCCTCAGTCCTTAGCTGG - Intergenic
1034865269 7:154636350-154636372 CTGGCTCCTGTGTCCTGAGCAGG - Intronic
1035407240 7:158607155-158607177 CTCCCACCTGGCTTCTGAGTGGG - Intergenic
1036016324 8:4788859-4788881 CTCCTTCCTGACTCCAGGGCAGG + Intronic
1037912671 8:22753267-22753289 CTCCCTCCTGACTCCTGAGCAGG - Intronic
1038013725 8:23495773-23495795 TTCACTCCTGACTCCTGCACAGG + Intergenic
1038345660 8:26730134-26730156 CTCCTGCCTGACTGATGAGCTGG + Intergenic
1038365700 8:26931244-26931266 CCTGCTCCTGACTCCTGAACAGG + Intergenic
1038780469 8:30565256-30565278 CTCACTCTTGATTCCAGAGCTGG + Intronic
1039355367 8:36809603-36809625 CTCCTTCCTGAGTGCTGAGGAGG - Intronic
1041662567 8:60413779-60413801 CTCCCTACTCACTCCTGACCAGG - Intergenic
1043766538 8:84141000-84141022 TTCCCTGCTGTCTCTTGAGCTGG - Intergenic
1047905740 8:129471358-129471380 CTCCTGCCTGACTGTTGAGCTGG - Intergenic
1049017347 8:139930237-139930259 CTCCATCCCAACTCCTGAGATGG + Intronic
1049244451 8:141554555-141554577 CTGCCTCGTGCCTTCTGAGCAGG - Intergenic
1049367262 8:142246417-142246439 CTGGCTCCTGACTCCTCAGATGG - Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049569746 8:143363749-143363771 CTCCAGCCTGGCCCCTGAGCTGG + Intergenic
1049649665 8:143759687-143759709 CCCCCACCTGACTCCCTAGCTGG - Intergenic
1049819824 8:144626826-144626848 CCCCCTCCTGACACTTGAGTGGG + Intergenic
1049906819 9:225411-225433 CTCCCTCCTCACTCCTCCCCTGG - Intronic
1050258182 9:3815156-3815178 CTCCCTCCTCACACCTGGTCTGG - Intergenic
1050266720 9:3898528-3898550 ACCCCTTCTGATTCCTGAGCTGG - Intronic
1052337066 9:27330968-27330990 CTCCCACCTGACTTCCCAGCAGG + Intronic
1053342655 9:37350915-37350937 CTGCCTCCTGACACCAGATCTGG - Intronic
1056217236 9:84416636-84416658 TTACCTGCAGACTCCTGAGCAGG - Intergenic
1056300028 9:85231109-85231131 CTCCCTCCTCACTGCTAAGGTGG - Intergenic
1056454726 9:86748781-86748803 CTCCCTGCAGAGTCCTGAGGTGG - Intergenic
1056708106 9:88968855-88968877 CTCCTTCCAGACTCCTTGGCTGG - Intergenic
1057271419 9:93653699-93653721 CTGCCCCCTGGCTCCTGTGCGGG - Intronic
1057546310 9:96022040-96022062 CTCCCTCCCGCCTCCGAAGCCGG + Intergenic
1058101061 9:100917967-100917989 CACCGTCCAGATTCCTGAGCAGG - Intergenic
1060268226 9:122124613-122124635 GGCCCTCCTGCCTCCTTAGCTGG + Intergenic
1060833731 9:126739147-126739169 CTCGCTCCTAACCCCTGAGGAGG - Intergenic
1061386163 9:130290496-130290518 TTCCCTCCTGACCCCTGACAAGG + Intronic
1061574275 9:131496479-131496501 TCCCCTCCTGATTCCTCAGCTGG + Exonic
1186103490 X:6181579-6181601 CTCTCTGCTGATTCCTGAGGTGG + Intronic
1190228443 X:48563174-48563196 CTCCCTCCAGACACCCGGGCTGG + Intergenic
1192142808 X:68659833-68659855 CCCCATCCTGACTCCTCACCTGG - Intronic
1192892666 X:75407423-75407445 CTCCCACCTCCCTCCTGGGCAGG - Intronic
1193560253 X:83009374-83009396 CTCCCTCCTTAAGCCTAAGCTGG - Intergenic
1198210296 X:134509925-134509947 CTCCCTGCTGGCTCCCCAGCAGG + Intronic
1199980516 X:152918006-152918028 CTCCCTCCTGCCTCCAGATTTGG - Intronic
1200129529 X:153833444-153833466 CTCCAGCCTGACTGCTGTGCTGG - Intergenic
1201014847 Y:9590417-9590439 CTGACTCCTGACCCCTGAGCAGG + Intergenic