ID: 1037913486

View in Genome Browser
Species Human (GRCh38)
Location 8:22758239-22758261
Sequence AAGGGTCACCGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037913486_1037913496 24 Left 1037913486 8:22758239-22758261 CCATCTTCCCTCCGGTGACCCTT 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1037913496 8:22758286-22758308 TGCCTGGTACTGAATGTTCCTGG No data
1037913486_1037913490 -6 Left 1037913486 8:22758239-22758261 CCATCTTCCCTCCGGTGACCCTT 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1037913490 8:22758256-22758278 ACCCTTTCACTTCGTGTCTGTGG No data
1037913486_1037913499 28 Left 1037913486 8:22758239-22758261 CCATCTTCCCTCCGGTGACCCTT 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1037913499 8:22758290-22758312 TGGTACTGAATGTTCCTGGGTGG No data
1037913486_1037913493 8 Left 1037913486 8:22758239-22758261 CCATCTTCCCTCCGGTGACCCTT 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1037913493 8:22758270-22758292 TGTCTGTGGTACCCAGTGCCTGG No data
1037913486_1037913497 25 Left 1037913486 8:22758239-22758261 CCATCTTCCCTCCGGTGACCCTT 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1037913497 8:22758287-22758309 GCCTGGTACTGAATGTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037913486 Original CRISPR AAGGGTCACCGGAGGGAAGA TGG (reversed) Intronic
902703201 1:18186965-18186987 GATGGTCACAGGAGGGATGATGG - Intronic
903684353 1:25120090-25120112 AGGGGGCTCAGGAGGGAAGAAGG - Intergenic
904405185 1:30283759-30283781 GAGGGTCACAGGAGGGTACATGG + Intergenic
905454137 1:38075949-38075971 AAGGTTCCCAGGAAGGAAGAGGG + Intergenic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
906965961 1:50456791-50456813 AAGGGCCACAAGAGGGAAAAGGG + Intronic
907385199 1:54121507-54121529 AACGGTCACAGGAGGGACTAGGG + Intergenic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
909481364 1:76131390-76131412 AAGGGACCCCTGAGGGAAGACGG + Intronic
910047370 1:82933832-82933854 CAGGGTCACAGCAGTGAAGAAGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911582287 1:99647859-99647881 AAGGTACACTGGAGGGAAAAAGG - Intronic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912799556 1:112712471-112712493 AAGGGTCAGAGGTGGGTAGAAGG + Intronic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
915943753 1:160135419-160135441 ATGGCTCCCTGGAGGGAAGACGG - Exonic
917168186 1:172137789-172137811 AAGGGTAAAAGGTGGGAAGATGG - Intronic
919881753 1:201905650-201905672 ATGGGTCACAGGAAGGAAGAAGG - Intronic
920378628 1:205522933-205522955 GAGGGTCACTGGGAGGAAGAAGG + Intronic
921162513 1:212483260-212483282 GAGGGTCACAGGAGCGAGGAAGG - Intergenic
921374555 1:214460367-214460389 AAGGGTCATGGAAGGGAAGGAGG - Intronic
921584746 1:216933891-216933913 AGGGGTCAGTGGAGGGAAGATGG - Intronic
923031071 1:230249374-230249396 AGGGGAAACCGGAGGGCAGAAGG - Intronic
923876014 1:238048198-238048220 AAGGATGACAGGAGGTAAGAAGG + Intergenic
924382268 1:243475445-243475467 AAGAGGCGCCGGAGGGAAGGGGG - Intronic
1063115212 10:3067778-3067800 TGGGGTGACCGGAGAGAAGAGGG + Intronic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063653287 10:7961937-7961959 AAGGGTCACCTGAGCCCAGAAGG - Intronic
1064301846 10:14129942-14129964 GAGGGCCACCACAGGGAAGAGGG - Intronic
1066457951 10:35587942-35587964 AAGGCTCACATGAAGGAAGATGG + Intergenic
1068429985 10:56919269-56919291 AATGGAAACCTGAGGGAAGAAGG - Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069679983 10:70277572-70277594 GGGGGTCACTGGAGAGAAGAGGG - Intronic
1073825869 10:107320650-107320672 AAGGCTCACAGCAGTGAAGATGG - Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1077101054 11:822584-822606 CAGGGGCTCCGGCGGGAAGAGGG - Exonic
1078484361 11:11707854-11707876 CAGGGTCACTGGAGTGAAGGTGG + Intergenic
1081771262 11:45651778-45651800 AGGGGACACAGGAGGTAAGAGGG - Intronic
1082794597 11:57370064-57370086 AAGGGGCATGGGAGGGAAGAGGG + Exonic
1085803597 11:79613950-79613972 AAGGCTCATGGGAGGGAAGAAGG - Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089396666 11:118140641-118140663 AAGGGGAAGGGGAGGGAAGATGG - Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090355966 11:126140526-126140548 AAGGGTCTCAGCTGGGAAGAGGG + Intergenic
1094738779 12:33264545-33264567 AAGGAACAAAGGAGGGAAGAAGG - Intergenic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1096412404 12:51386892-51386914 AAGGGTCAGGGGTGGGAGGAGGG - Intronic
1101174198 12:102131834-102131856 AAGGGTGACGGGTGGGAGGAGGG + Intronic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1105686680 13:22790141-22790163 AAGTCTCACCTGAGGGCAGATGG + Intergenic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108675577 13:52735148-52735170 AAGGGCCACCTGAGGGGAAAGGG - Intronic
1109264623 13:60183096-60183118 AAGGGTCACCTGAGGCCAGGAGG + Intergenic
1112429356 13:99336935-99336957 AGGGGTCACAGGAGGGAGGTGGG - Intronic
1113662491 13:112117100-112117122 AAGGGACACGGGCGTGAAGATGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114317519 14:21522418-21522440 AAGGGTCACACCAGGGAAGCTGG + Exonic
1116743659 14:48790524-48790546 AAGGATGAAAGGAGGGAAGAAGG + Intergenic
1117412801 14:55466041-55466063 ATGGATCACATGAGGGAAGAAGG + Intergenic
1118347089 14:64948303-64948325 ACGGGCCTCCTGAGGGAAGAGGG + Exonic
1119224926 14:72937763-72937785 AAGGGTAACAGGAAGGAAGTGGG + Intronic
1121800323 14:96769123-96769145 AAGGGAGAGGGGAGGGAAGAAGG - Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1122501341 14:102202104-102202126 AAGGGACACCGTAGGGGAGGAGG - Intronic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1125575270 15:40751033-40751055 AAGGCTCCCCTGTGGGAAGAGGG + Intronic
1126936450 15:53714265-53714287 AAGGCTCACCCCTGGGAAGATGG + Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1133982822 16:10646291-10646313 AAGAGTCACTGGGGGGAAGCTGG - Intronic
1135723422 16:24835982-24836004 AGGGGTCACAGAGGGGAAGAAGG - Intergenic
1136153417 16:28366586-28366608 AAGGGTGACAGGAGGGAAACGGG + Intergenic
1136209669 16:28748681-28748703 AAGGGTGACAGGAGGGAAACGGG - Intergenic
1136332185 16:29587470-29587492 GAGGGTCAGAGGAGGGAAAATGG - Intergenic
1138451361 16:57095032-57095054 AAGGTTCAGGGGAGGGGAGAGGG - Intronic
1141025229 16:80540807-80540829 GTGGGTCCCGGGAGGGAAGAGGG - Intronic
1142198026 16:88747809-88747831 CAGGGTTACCGCAGGGGAGAGGG + Intronic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1145823540 17:27858983-27859005 AAAGGGCACGGGAGAGAAGAAGG + Intronic
1146754126 17:35411328-35411350 AAGGCTCACCTGATGGAAAATGG - Exonic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148691317 17:49528491-49528513 AGGGGTGGCCTGAGGGAAGAGGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1153344501 18:4011270-4011292 AAGTGCCACCGGAAGGGAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157852166 18:51065311-51065333 AAGGGTAAAGGGAGGGGAGATGG - Intronic
1160659375 19:291165-291187 CAGGGTCCTCGGAGGGACGAGGG + Exonic
1161702812 19:5804583-5804605 AGGGGTCCCCGGAGTGAGGATGG + Intergenic
1161821522 19:6533508-6533530 AGGGGTCTCTGGAGGGGAGAGGG - Intronic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1164794385 19:31014507-31014529 AAGGGTCGGGGGAGGGAAGAAGG + Intergenic
1165077630 19:33289645-33289667 AAGGCCCATGGGAGGGAAGAAGG - Intergenic
1165243854 19:34486701-34486723 AGGGGTCCCAGGAGGGAGGAAGG - Intronic
1166356504 19:42230476-42230498 AAGGGACACAGGAGGGGAGGGGG + Exonic
1166566257 19:43767332-43767354 AAGGGTCAGTGAAGGGGAGAGGG + Intronic
1168405307 19:56107570-56107592 AAGGGTCACCAGGAGAAAGAGGG + Intronic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925746314 2:7046651-7046673 AAGGAAAACAGGAGGGAAGAGGG - Intronic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
928332627 2:30369287-30369309 ATGGGGCACCGGCTGGAAGAGGG + Intergenic
931767300 2:65468177-65468199 AAGGGGCATCGGAGTGGAGAAGG + Intergenic
932144087 2:69304007-69304029 AAGGCTCATCTGAGGGAGGAGGG + Intergenic
934854841 2:97723310-97723332 AAGGGTCAGCGGAAGGGACAAGG + Intronic
935130750 2:100259136-100259158 AAGGGTCACCTTAAGGAAGCTGG + Intergenic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
936458439 2:112693201-112693223 AATGGGCACAGGAGAGAAGAGGG + Intergenic
946322399 2:218961493-218961515 AAGGCAGACAGGAGGGAAGATGG - Exonic
947297721 2:228651107-228651129 AAGGGTGGCAGGTGGGAAGAGGG + Intergenic
947534680 2:230933341-230933363 AAGGGCCAACGGAGGGCAGGTGG - Intronic
947611578 2:231528098-231528120 AAGTGTCACGGCTGGGAAGAGGG - Intronic
947675371 2:231974240-231974262 AAGGGACAGGGGAGGGAAGCTGG + Intronic
947736776 2:232459300-232459322 AAGGGGATGCGGAGGGAAGAAGG - Exonic
948079710 2:235195744-235195766 AAGATTCACCTGAGGAAAGAGGG - Intergenic
948214066 2:236215737-236215759 AAGGACCAGCGGAGGGCAGAGGG - Intronic
948774253 2:240273974-240273996 AAGGGTCACAGGCAGGAAGAGGG + Intergenic
948822818 2:240558432-240558454 AAGAGTCACCGCAGAGAAGAGGG + Intronic
1170199097 20:13723186-13723208 AAAGTTCACTGGAGGGCAGATGG + Intronic
1170859175 20:20086886-20086908 AAGAGTCACCGGAGGGTGTAGGG + Intronic
1172004802 20:31811782-31811804 AAAGGACACTGGAGGGCAGATGG - Intergenic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1175030732 20:55951189-55951211 AAGGGTCCTGAGAGGGAAGATGG + Intergenic
1175367587 20:58466702-58466724 AAGGGTCACCTGCGGGAAACGGG + Intronic
1175716764 20:61260173-61260195 AAGGAACACTGGAGGGTAGAGGG - Intronic
1176968435 21:15237914-15237936 AAGGGTGACCCTAGAGAAGAGGG + Intergenic
1180046537 21:45308880-45308902 AAGGGTCCCTTGCGGGAAGAGGG - Intergenic
1180119288 21:45736201-45736223 AAGGGGCACTGGGAGGAAGAAGG - Intronic
1181019280 22:20090281-20090303 ATGGGTCCCAGGAGGCAAGAAGG - Intronic
1182360444 22:29743518-29743540 AAGGATCACCTGAGTGCAGAAGG - Intronic
1182800348 22:33026975-33026997 AAGGGAGGCAGGAGGGAAGAAGG - Intronic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
949518778 3:4830816-4830838 AAGGGTCATGGGGGAGAAGATGG - Intronic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
950424877 3:12919749-12919771 CAGGGTCCCCGGAAGGAAGGAGG - Intronic
950426971 3:12929596-12929618 AAGGGCATCCGGAGGGTAGAGGG - Intronic
950704167 3:14769755-14769777 TAGGGGCACTGGATGGAAGAGGG + Intronic
951272235 3:20640251-20640273 ATGGCTCACAGGAGGGAGGAAGG + Intergenic
951723171 3:25723907-25723929 ATGGGTCACTGGTGGGAGGAGGG - Intronic
954390972 3:50267772-50267794 AAGTGTCAGCGGAGGGAAGGAGG + Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954676305 3:52317615-52317637 AAAGGGCACAGGAGGGAAGATGG + Intronic
955852999 3:63241178-63241200 AAAGGTCAAAGGAGGAAAGAGGG + Intronic
956907635 3:73783035-73783057 AAGGCTCAGAGGAGGCAAGAGGG + Intergenic
960122308 3:113959092-113959114 GAGGGTCACGTGAGGGAAGATGG + Intronic
962203054 3:133415766-133415788 AAGGGTAAGTGGAGGGGAGATGG - Intronic
962643218 3:137409961-137409983 AAGGTTCACTGGGAGGAAGATGG - Intergenic
962810008 3:138951584-138951606 ACGGGTCTTTGGAGGGAAGAGGG - Exonic
963009863 3:140759111-140759133 AAGGGGCACCGGAGGGAGGGAGG - Intergenic
967828578 3:193898846-193898868 AAGGCCCACTGGAGGGAATAGGG - Intergenic
967888943 3:194351401-194351423 CAGGGTCACAGGACGGGAGAGGG + Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968448963 4:666250-666272 AAGGGTCCCCAGAGCCAAGAGGG + Intronic
968496171 4:917646-917668 AAGGGTTACCGTGGGGAGGAGGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970861427 4:20707530-20707552 AAAGGTCACAGTGGGGAAGAAGG + Intronic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
978715170 4:111833352-111833374 GAGGGTCACTGGATGAAAGATGG + Intergenic
979666201 4:123313484-123313506 AACGGTCAAGGGAGGGCAGAGGG - Intronic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
980488332 4:133490656-133490678 AAGGGTCATGGGAGGGAAACTGG + Intergenic
981390975 4:144191138-144191160 AAGGGTCACCAGAGAGCAGGAGG - Intergenic
983168886 4:164513253-164513275 AAGGGTGACAGGAGAAAAGAAGG + Intergenic
985694332 5:1331398-1331420 AAGGAACACCGGCGGGAGGACGG + Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987318858 5:16749188-16749210 AAGGTTTACGGAAGGGAAGAAGG - Intronic
989063987 5:37441136-37441158 AATTGTAACAGGAGGGAAGAAGG + Intronic
990291616 5:54357744-54357766 AAGGGCCACCTGAGAGAAGCAGG + Intergenic
991666759 5:69006981-69007003 GAGGGGCACAGGAGGGAAGAAGG + Intergenic
994417797 5:99496966-99496988 AATTGTAACAGGAGGGAAGAAGG + Intergenic
994462168 5:100078190-100078212 AATTGTAACAGGAGGGAAGAAGG - Intergenic
994648703 5:102500430-102500452 AAGGGTCAGTGGAGGTAGGAGGG - Intergenic
995875317 5:116783439-116783461 TGGGGTCAGCGGAGGGGAGAGGG - Intergenic
996551498 5:124735335-124735357 ACGGGTCCCTGGCGGGAAGAAGG + Intronic
996744554 5:126835229-126835251 AAGGTTCATAAGAGGGAAGATGG + Intronic
997211796 5:132081211-132081233 AAGGGGCACTGGTGGGAAGCTGG + Intergenic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1001833496 5:174809488-174809510 AAGAGTTACAGGAAGGAAGAGGG - Intergenic
1001855551 5:175007549-175007571 AAGGGAAAAGGGAGGGAAGAAGG - Intergenic
1002820128 6:717126-717148 AAGGCTGACCGGAGGGCAGGGGG + Intergenic
1004286172 6:14322806-14322828 AGGGGACTCCAGAGGGAAGAGGG + Intergenic
1004320857 6:14630400-14630422 AGGGGCCACCTGAGGGGAGAGGG + Intergenic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1006384208 6:33720153-33720175 AAGGGTGACAGGAGTGGAGAAGG - Intergenic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1008191539 6:48464023-48464045 AAGGGTCACTGGGGTAAAGAAGG + Intergenic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015539527 6:134300097-134300119 AAGGTTTTCCTGAGGGAAGAAGG - Intronic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017782233 6:157724502-157724524 AAGGGTCAGTGGTTGGAAGAGGG - Intronic
1018247798 6:161839223-161839245 AAGGTGCCCCTGAGGGAAGAAGG + Intronic
1018463652 6:164022646-164022668 ACAGGCCACGGGAGGGAAGAGGG + Intergenic
1018923753 6:168193116-168193138 AAGGATAGCCGGAGGGATGAGGG + Intergenic
1019415620 7:925445-925467 AGGGGAGGCCGGAGGGAAGAGGG - Intronic
1019775068 7:2907516-2907538 AGGGGCTGCCGGAGGGAAGATGG - Intronic
1019886919 7:3913256-3913278 AAAGGTCAGAGGAGGGGAGAGGG - Intronic
1022344782 7:29503614-29503636 CATGGTCACAGGAGGGATGAGGG + Intronic
1023600120 7:41874435-41874457 AAAGCTCCCAGGAGGGAAGATGG + Intergenic
1024113386 7:46169839-46169861 TAGGATCAGCGGAGGGAAGGAGG + Intergenic
1025073967 7:55926439-55926461 AACAGTCACCTTAGGGAAGACGG - Intronic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1035108852 7:156463821-156463843 AGGTGTCACCTGGGGGAAGAGGG + Intergenic
1037220215 8:16509976-16509998 AAGGCTCACCTGGGAGAAGAAGG - Intronic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1041362607 8:57068662-57068684 AAGGGGCACCAGAAGGAACAAGG + Intergenic
1044689785 8:94865417-94865439 AAGGCACACTGGAGGAAAGATGG - Intronic
1046732053 8:117736479-117736501 AAGGGACAAAAGAGGGAAGATGG + Intergenic
1048405568 8:134116683-134116705 ATGGGTCCCCTGAGTGAAGACGG + Intergenic
1049031835 8:140043863-140043885 GAGGGCCACTGGAGGGGAGAGGG - Intronic
1053434408 9:38065976-38065998 CAGGGTTACAGGAGGGATGAAGG - Intronic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1055018504 9:71644852-71644874 AAGGGACTAAGGAGGGAAGAAGG - Intergenic
1055272085 9:74572560-74572582 GCGGGTCACAGGAGGGAAAAAGG + Intronic
1056831520 9:89920896-89920918 AAGTGTCACTGGGGCGAAGATGG + Intergenic
1057818201 9:98311279-98311301 ATGGCTCACAGGAGGGAAAAGGG - Intronic
1058869675 9:109191120-109191142 AAGGGTCCTAGAAGGGAAGAGGG - Intronic
1058896862 9:109407920-109407942 AAGGGGCACTGGTGGAAAGATGG + Intronic
1060522318 9:124300783-124300805 AAGGGCCACCGCAGGGGAGGGGG + Intronic
1062362608 9:136194757-136194779 AAGGGGAAGGGGAGGGAAGAGGG - Intergenic
1185700463 X:2227549-2227571 AAGGGAGAAAGGAGGGAAGAAGG + Intronic
1188468020 X:30504928-30504950 AAGGGTCAGCAGAGGAAACATGG - Intergenic
1188565530 X:31522258-31522280 AAGTAACTCCGGAGGGAAGAGGG + Intronic
1192216825 X:69165008-69165030 AAGGGGCCGAGGAGGGAAGAAGG + Intronic
1195067660 X:101252316-101252338 AAGGGAGACAGGAGGGAAGCAGG - Intronic
1197166300 X:123381340-123381362 AAGGGTCAGTGGTAGGAAGATGG - Intronic
1198229604 X:134676447-134676469 AACTGTCTCCTGAGGGAAGAGGG + Intronic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200934333 Y:8725013-8725035 AAGGCTCACCTGAAAGAAGAAGG + Intergenic