ID: 1037914041

View in Genome Browser
Species Human (GRCh38)
Location 8:22761210-22761232
Sequence ACCCCACAGTTCCCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037914041 Original CRISPR ACCCCACAGTTCCCCGGGGC AGG (reversed) Intronic
900183037 1:1320772-1320794 AGCCTACAGGACCCCGGGGCTGG + Intronic
900185248 1:1330399-1330421 GCCCCCCAGTTCCCCTGGGAGGG + Intergenic
900326865 1:2112505-2112527 ACCCCACAGTCCCCCATGCCGGG - Intronic
900758807 1:4456514-4456536 GCCACACAGTTCCACGTGGCTGG - Intergenic
901876268 1:12168567-12168589 ACCCCAGAGTTCACCCAGGCAGG - Intronic
902268636 1:15287382-15287404 GACTCACAGTTCCCCAGGGCTGG + Intronic
902672295 1:17983222-17983244 AGCCCTCAGCTCCCAGGGGCTGG - Intergenic
902760749 1:18579342-18579364 AACTCACAGTTCCGCAGGGCTGG + Intergenic
902791225 1:18769522-18769544 ACTCCAAAGTTCCATGGGGCTGG - Intergenic
902897035 1:19485873-19485895 ACCCCACAGTCCCCGCGGGCGGG + Intergenic
905791564 1:40792316-40792338 TCCCCACTGTGCCCAGGGGCTGG - Intronic
907277694 1:53326364-53326386 ACCCCATAGGCCCCCGTGGCCGG - Intronic
907343871 1:53758296-53758318 ATCTCACAGTTCCACGTGGCTGG + Intergenic
907479822 1:54737788-54737810 AACTCACAGTTCCACGTGGCTGG + Intronic
914356943 1:146894694-146894716 AACTCACAGTTCCACAGGGCTGG + Intergenic
915977354 1:160400210-160400232 AGCCCCCAGATCCCTGGGGCTGG - Intergenic
916993103 1:170266170-170266192 GACCCACAGTTCCACAGGGCTGG + Intergenic
917035303 1:170742090-170742112 GCCTCACAGTTCCACAGGGCTGG + Intergenic
917838616 1:178959868-178959890 AACTCACAGTTCCACGTGGCTGG - Intergenic
919640102 1:200038799-200038821 ACCCCACCCTGGCCCGGGGCGGG - Intronic
919860210 1:201734938-201734960 ACCCCACAGTTGGGAGGGGCAGG - Intronic
920549610 1:206847296-206847318 GCTCCACTGTTCCCCAGGGCAGG - Intergenic
920841189 1:209555373-209555395 ACCCCGCTGATCCCCAGGGCAGG + Intergenic
922842027 1:228650399-228650421 ACCCCACAGCCGCCCCGGGCTGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1064011342 10:11739007-11739029 AACTCACAGTTCCACGTGGCTGG + Intergenic
1065440692 10:25750568-25750590 AACTCACAGTTCCACGTGGCTGG - Intergenic
1066579733 10:36867102-36867124 ATCTCACAGTTCCCTGGGTCAGG - Intergenic
1068243690 10:54337466-54337488 GACCCACAGTTCCACGTGGCTGG - Intronic
1069982418 10:72261445-72261467 ACCCCAGAGCTCCCAGGGGGAGG + Intergenic
1071873298 10:89818038-89818060 GACCCACAGTTCCACGTGGCTGG + Intergenic
1073883080 10:108006559-108006581 AACTCACAGTTCCACGTGGCTGG + Intergenic
1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG + Intronic
1077394027 11:2312418-2312440 TCCCCGCAGTGCCCAGGGGCGGG - Intronic
1077527686 11:3077387-3077409 ACGCCAGAGTGCCCCGGTGCAGG - Intergenic
1077551644 11:3203150-3203172 TCTTCAAAGTTCCCCGGGGCTGG - Intergenic
1078686767 11:13539151-13539173 AACTCACAGTTCCACGTGGCTGG - Intergenic
1079962307 11:26940050-26940072 AACTCACAGTTCCACGTGGCTGG + Intergenic
1081767978 11:45625584-45625606 AACTCACAGTTCCACGTGGCTGG + Intergenic
1082211053 11:49501834-49501856 AACTCACAGTTCCACGTGGCTGG - Intergenic
1082771453 11:57210925-57210947 ACCTCAAGGTTCCCAGGGGCAGG - Intergenic
1083925486 11:65803650-65803672 AGACCACAGGTGCCCGGGGCTGG + Intergenic
1088219954 11:107559184-107559206 AACCCACAGTTCCACGTGGCCGG - Intronic
1088772323 11:113047677-113047699 GGCTCACAGTTCCCCAGGGCTGG + Intronic
1089685733 11:120145591-120145613 ACTCCACTGTGCCCAGGGGCAGG - Intronic
1091347589 11:134865462-134865484 GCCCCACAGTTCCCCAGGAATGG - Intergenic
1093681769 12:22010622-22010644 AACCCACAGTTCCACGTGGTTGG - Intergenic
1094663870 12:32498956-32498978 TCTGCACAGTGCCCCGGGGCAGG - Intronic
1096063152 12:48719135-48719157 AACTCACAGTTCCACGTGGCTGG + Intergenic
1096597961 12:52709215-52709237 ACCCTACATTTCCCAGGGTCTGG + Intergenic
1096621424 12:52867991-52868013 ACCTCTCAGTTCCCCCTGGCAGG - Intergenic
1096985103 12:55750976-55750998 ACCCCAGAGTCCCCTGGGTCTGG + Exonic
1097860233 12:64511590-64511612 ACCCCAAAGTGCCCTGGAGCAGG - Intergenic
1098686838 12:73433245-73433267 ACCTCACAGTTCCACATGGCTGG - Intergenic
1099609616 12:84850928-84850950 ACCTCATAGTTCCACAGGGCTGG - Intergenic
1099791425 12:87339822-87339844 GACCCACAGTTCCACGTGGCTGG + Intergenic
1100201854 12:92306995-92307017 AACCCACAGTTCCACATGGCTGG - Intergenic
1102745893 12:115248809-115248831 AACTCACAGTTCCACGTGGCTGG + Intergenic
1102826381 12:115950891-115950913 AACTCACAGTTCCACGTGGCTGG + Intergenic
1103867545 12:124064748-124064770 ACCCAACAGCCCCCTGGGGCAGG - Intronic
1103880748 12:124164123-124164145 ACCCCACATTTCCCCTGCACTGG + Intronic
1103918839 12:124389200-124389222 AGCCCACAGACCCCCGGGCCGGG + Intronic
1104386004 12:128352202-128352224 GACTCACAGTTCCACGGGGCTGG + Intronic
1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG + Intergenic
1104929236 12:132329457-132329479 CCCTCACCGCTCCCCGGGGCGGG - Intergenic
1104964331 12:132502257-132502279 ACCCCACTGGTGGCCGGGGCAGG + Intronic
1105837582 13:24224355-24224377 AGCCCCCAGAGCCCCGGGGCAGG + Exonic
1106386886 13:29295729-29295751 ACTCAACAGTTCCCCATGGCTGG + Intronic
1106394353 13:29366192-29366214 AACTCACAGTTCCACGTGGCTGG + Intronic
1106917266 13:34529192-34529214 ATTCCACAAATCCCCGGGGCAGG - Intergenic
1107739538 13:43434540-43434562 ACCCCAGAGTTCCCCAAGGGTGG + Intronic
1107886478 13:44878035-44878057 AATCCACAGTTCCACGTGGCTGG - Intergenic
1108788949 13:53943085-53943107 GACCCACAGTTCCACGTGGCTGG + Intergenic
1108851009 13:54728842-54728864 GACCCACAGTTCCACGTGGCTGG - Intergenic
1110018627 13:70440561-70440583 AACCCACAGTTCCATGTGGCTGG + Intergenic
1110124999 13:71931678-71931700 GACTCACAGTTCCCCAGGGCTGG - Intergenic
1110318414 13:74134995-74135017 ACCCCATTGTTGCCCGGCGCGGG - Intergenic
1112159573 13:96853608-96853630 AACTCACAGTTCCACGTGGCTGG - Intergenic
1112904048 13:104395359-104395381 TTCCCACACTTCCCCTGGGCAGG + Intergenic
1113607708 13:111622252-111622274 GCCCCGCAGGTCCCAGGGGCTGG - Intronic
1113727621 13:112616905-112616927 AAGCCACAGTTCCCGGGGTCAGG - Intergenic
1113811523 13:113145647-113145669 AACTCACAGTTCCACGTGGCTGG + Intronic
1113896861 13:113770136-113770158 AACTCACAGTTCCACGTGGCTGG + Intronic
1113912221 13:113848166-113848188 TCCCCTCAGTTCCCCGGGTGGGG - Intronic
1116339928 14:43709321-43709343 AACTCACAGTTCCACAGGGCTGG - Intergenic
1118050242 14:62018678-62018700 ACTCCACATCTCCCCAGGGCTGG + Intronic
1118071048 14:62246749-62246771 AACTCACAGTTCCACGTGGCTGG - Intergenic
1118395233 14:65330530-65330552 ACCTCACTTTTCCCTGGGGCAGG + Intergenic
1121479952 14:94258926-94258948 AACTCACAGTTCCACGTGGCTGG + Intronic
1121630872 14:95421111-95421133 AACTCACAGTTCCACGTGGCTGG - Intronic
1121774453 14:96581525-96581547 ATCTCAGAGGTCCCCGGGGCGGG - Intergenic
1121791614 14:96703540-96703562 AACTCACAGTTCCACGTGGCTGG - Intergenic
1122686657 14:103511447-103511469 CCCCCACAGGTCCTGGGGGCGGG - Intergenic
1122792332 14:104189264-104189286 GCCTCACAGTGCCACGGGGCTGG + Intergenic
1123771397 15:23533523-23533545 ACCCCACACTTTCTAGGGGCTGG - Intergenic
1125510098 15:40288203-40288225 ACCTCACAGCTCCCTGGGGACGG - Exonic
1125589386 15:40844787-40844809 CCCCCACCGTGCGCCGGGGCTGG + Exonic
1126532621 15:49727617-49727639 AACTCACAGTTCCACGTGGCTGG - Intergenic
1127951864 15:63815802-63815824 GCCTCACAGTTCCACAGGGCTGG + Intronic
1128309373 15:66620920-66620942 ACCCCACAGCTGCCCTGGGAAGG + Intronic
1130835133 15:87643113-87643135 ACCTCACAGTTCCACATGGCTGG + Intergenic
1131738523 15:95361059-95361081 ATCTCACAGTTCCACGTGGCTGG + Intergenic
1131832385 15:96361852-96361874 ACCCCACAGTCTACCGGGTCAGG - Intergenic
1131964839 15:97830840-97830862 AACTCACAGTTCCACGTGGCTGG + Intergenic
1132550971 16:553694-553716 ACCCCACAGTCCGCCTGGCCAGG + Exonic
1134276042 16:12776967-12776989 GCCTCACAGTTCCACGTGGCTGG - Intronic
1136355761 16:29744243-29744265 TCCCCAGAGATCCCCGAGGCAGG - Exonic
1136414402 16:30095007-30095029 CTCCCAGAGTTCCCCGGTGCAGG - Intronic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1139845426 16:69917717-69917739 AACGCACAGATCCCCGAGGCAGG + Exonic
1141806253 16:86343579-86343601 ACCCCACCCCTTCCCGGGGCAGG - Intergenic
1142147463 16:88498577-88498599 ACCCCACATGTCCGAGGGGCAGG + Intronic
1142371839 16:89686917-89686939 GTCCCAGAGTTCCCCGCGGCGGG + Intronic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142547494 17:714875-714897 ATCCCACAGTTCCCCGGTCCCGG - Intronic
1142665393 17:1460337-1460359 ACCCCCCACTTCCCCAGAGCAGG - Intronic
1143401880 17:6651617-6651639 ATCCCACAGTGCCCCGGGACCGG - Exonic
1145019439 17:19417971-19417993 ACCACACACTTCCCTGGAGCTGG - Intergenic
1146309276 17:31754726-31754748 ACACCACAGTTAGCAGGGGCAGG - Intergenic
1146663900 17:34683855-34683877 GACCCACAGTTCCACGTGGCTGG + Intergenic
1148751094 17:49946327-49946349 AACCCACAGTGCCCTGAGGCAGG - Intergenic
1151106299 17:71620078-71620100 AACTCACAGTTCCACGTGGCTGG - Intergenic
1151970414 17:77454745-77454767 ACCCCACCGGGCCCCGGAGCGGG + Intronic
1152124449 17:78437978-78438000 ACCCCACACTTGCCTGGTGCTGG + Intronic
1152260049 17:79261891-79261913 AACCCACAATTCCGCGGGGCCGG - Intronic
1152716159 17:81901864-81901886 ACTGCACAGTGCCCCGGGGGCGG - Intronic
1155192124 18:23439245-23439267 GACTCACAGTTCCACGGGGCTGG - Intergenic
1156749670 18:40436288-40436310 GCCTCACAGTTCCACGTGGCTGG - Intergenic
1158577706 18:58653277-58653299 AACTCACAGTTCCACGTGGCTGG + Intergenic
1160010497 18:75104093-75104115 GCCTCACAGTTCCACGTGGCAGG + Intergenic
1160808714 19:1003655-1003677 TCCCCGCAGTTGACCGGGGCGGG - Exonic
1163417482 19:17195347-17195369 CCGCCACAGTTCCACGGCGCTGG - Exonic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163727651 19:18931921-18931943 TCTCCACAGTTGCCCGGGCCAGG + Intronic
1165371586 19:35410687-35410709 GACTCACAGTTCCACGGGGCTGG + Intergenic
1167195826 19:48027516-48027538 GCCTCACAGTTCCACGTGGCTGG - Intergenic
1167497763 19:49829604-49829626 AACCCAGAGTCTCCCGGGGCAGG + Intronic
1167566216 19:50258952-50258974 AACTCTCAGTTCCCCAGGGCAGG + Intronic
925005466 2:439917-439939 ACCCCCCAGTTGCCCTGGCCTGG - Intergenic
925183288 2:1830717-1830739 CCTCCACAGTTCCCCAGGCCTGG - Intronic
926295333 2:11564829-11564851 GACCCACAGTTCCACGTGGCTGG + Intronic
926739259 2:16097517-16097539 AACTCACAGTTCCACGTGGCTGG + Intergenic
933520126 2:83361060-83361082 AACTCACAGTTCCACGTGGCTGG - Intergenic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
934559698 2:95306772-95306794 ACCCCACAGTGCCTTGGTGCTGG - Intronic
939758115 2:146138574-146138596 ATTCCACAGTTCCACGTGGCTGG + Intergenic
943488682 2:188521462-188521484 GACTCACAGTTCCACGGGGCTGG + Intronic
943776905 2:191775367-191775389 AACTCACAGTTCCACGTGGCTGG - Intergenic
945844133 2:214923232-214923254 CCCCCACTATTCCCAGGGGCTGG + Intergenic
946113680 2:217443485-217443507 GACTCACAGTTCCCCGTGGCTGG + Intronic
946228376 2:218276906-218276928 GCCCCAAAGGTCCCCGGGGCAGG - Intronic
946341706 2:219073758-219073780 ACCCGCCCGCTCCCCGGGGCTGG - Intergenic
946550266 2:220793557-220793579 AACTCACAGTTCCACGTGGCTGG - Intergenic
946867867 2:224058857-224058879 AACTCACAGTTCCACGTGGCTGG + Intergenic
947251161 2:228105824-228105846 AACTCACAGTTCCACGTGGCTGG - Intronic
947545808 2:231009404-231009426 CCCACACATTTCCCCGGGGATGG - Intronic
948043126 2:234920115-234920137 AACTCACAGTTCCACGTGGCTGG + Intergenic
948758379 2:240172968-240172990 AACTCACAGTTCCACGTGGCTGG + Intergenic
948894127 2:240920433-240920455 ACCCCACAGGGCTCCCGGGCAGG - Intronic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
949039079 2:241837605-241837627 AACTCACAGTTCCCCATGGCTGG - Intergenic
1170322168 20:15112004-15112026 ACCCCAGAGTTCACAGGGCCAGG + Intronic
1170751787 20:19154924-19154946 ACCTCACAGTTCCATGTGGCTGG + Intergenic
1170866772 20:20164818-20164840 AACTCACAGTTCCACGTGGCTGG + Intronic
1173122694 20:40308164-40308186 ACCTGACACTTCCCGGGGGCAGG - Intergenic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1173741011 20:45401741-45401763 AACTCACAGTTCCACAGGGCTGG - Intronic
1174709135 20:52686634-52686656 GACCCACAGTTCCACGTGGCTGG + Intergenic
1174804613 20:53594236-53594258 ACCCAACAGTCCCCCAGCGCCGG - Intronic
1175317451 20:58058878-58058900 ACACCACAGAGCCCCAGGGCAGG + Intergenic
1175527725 20:59647128-59647150 ACTCCACAGTTCCACATGGCTGG + Intronic
1175836420 20:61998589-61998611 AGACCACAGTTCCCCAGGGACGG - Intronic
1175861567 20:62153041-62153063 AACTCACAGTTCCACAGGGCTGG + Intronic
1176030418 20:63008740-63008762 GCTCCACAGGTCCCCGGAGCTGG + Intergenic
1176733398 21:10521611-10521633 ACCCAACAGTTACCCAGCGCCGG + Exonic
1177208773 21:18043792-18043814 GACCCACAGTTCCACAGGGCTGG + Intronic
1178122647 21:29484958-29484980 ACTCAACAGTTCCACGTGGCTGG + Intronic
1179584241 21:42364912-42364934 CCCCCACAGTGTCCCGGGGGTGG - Intronic
1179788701 21:43743466-43743488 TCCCCACAGTGCTCGGGGGCTGG - Intronic
1179788719 21:43743517-43743539 TCCCCACAGTGCTCAGGGGCTGG - Intronic
1179788737 21:43743568-43743590 TCCCCACAGTGCTCAGGGGCAGG - Intronic
1179889875 21:44330124-44330146 ACCCTCCAGCTCCCGGGGGCTGG + Exonic
1180059580 21:45377831-45377853 GCCCCACAGTGCCCAGGGGTTGG + Intergenic
1180848386 22:18997205-18997227 CCCCTACAGTTCCATGGGGCAGG - Intergenic
1180942435 22:19668089-19668111 GCCTCACAGTTCCACGAGGCAGG + Intergenic
1181068174 22:20316363-20316385 ACCCCACTGTCACCCAGGGCCGG + Intronic
1181514324 22:23402586-23402608 TCCGCCCAGTTCCCCTGGGCCGG + Intergenic
1182144783 22:27990713-27990735 ACCCCCGAGTTCCCCTGGGCAGG - Intronic
1182277047 22:29196193-29196215 CCCTCACAGCTTCCCGGGGCTGG + Intergenic
1182797980 22:33005119-33005141 AACTCACAGTTCCACGTGGCTGG - Intronic
1183068613 22:35380956-35380978 ACCCCACACTGGCCCGGGGCGGG + Exonic
1183535607 22:38398843-38398865 ACCCAACAGTCCCCCAGCGCCGG - Intergenic
1183589215 22:38770140-38770162 ACCACTGAGTTCCCAGGGGCCGG - Intronic
1183928563 22:41223272-41223294 ACCCAGCAGTGCCCTGGGGCTGG + Intronic
1183957195 22:41387824-41387846 TCCACACAGTTCCCCGAGGCTGG + Intronic
1184143617 22:42595092-42595114 ACCCCACAGTTCACTGTGCCTGG + Intronic
1184449539 22:44574798-44574820 ACCCTACACGTCCCAGGGGCTGG - Intergenic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
953963427 3:47283658-47283680 ACCACAAAGGTCCCCGGGGCTGG + Intronic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
956246127 3:67185686-67185708 ACCTCACAGTTCCACATGGCTGG + Intergenic
956528235 3:70188004-70188026 ACCCCACCTTTCCCCTGGGGAGG + Intergenic
956714544 3:72067115-72067137 GACCCACAGTTCCACGTGGCTGG + Intergenic
957113884 3:76000068-76000090 AACTCACAGTTCCACGTGGCTGG + Intronic
957261514 3:77907997-77908019 ACTCAACAGTTCCACGTGGCTGG - Intergenic
957880031 3:86200149-86200171 AACTCACAGTTCCACGTGGCTGG - Intergenic
958692119 3:97481566-97481588 ACCCAACAGTCCCCCAGCGCCGG - Intronic
959851960 3:111097756-111097778 AACTCACAGTTCCACAGGGCTGG - Intronic
962206579 3:133440039-133440061 AACCCACAGTTCCCCACGGCTGG + Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
963914950 3:150850515-150850537 GACTCACAGTTCCGCGGGGCTGG - Intergenic
968286719 3:197513203-197513225 ACCCCTCTGTTCCCAGGGCCAGG - Intronic
968764311 4:2460028-2460050 ACCCCACAGATCCCCGGCTACGG + Exonic
971056860 4:22922891-22922913 AACTCACAGTTCCACGTGGCTGG - Intergenic
972890884 4:43554566-43554588 AACTCACAGTTCCACTGGGCTGG - Intergenic
973175952 4:47204791-47204813 AACTCACAGTTCCACGTGGCTGG - Intronic
973747180 4:53975240-53975262 GACTCACAGTTCCCCAGGGCTGG - Intronic
974557167 4:63465833-63465855 AACCCACAGTTCCACATGGCTGG + Intergenic
975257699 4:72256619-72256641 AACTCACAGTTCCACGTGGCTGG - Intergenic
975419041 4:74140670-74140692 GACCCACAGTTCCACAGGGCCGG + Intronic
976319875 4:83702005-83702027 GACTCACAGTTCCCCGTGGCTGG + Intergenic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
979284146 4:118902363-118902385 AACTCACAGTTCCACGTGGCTGG + Intronic
981169570 4:141605645-141605667 GCCCCTCACTGCCCCGGGGCCGG + Intergenic
981336708 4:143576337-143576359 ACCCCACAGATCCCCTGGTTTGG - Intergenic
982797647 4:159664706-159664728 ATTCCACAGATCCCCAGGGCAGG + Intergenic
983894067 4:173062775-173062797 AACTCACAGTTCCACGTGGCTGG - Intergenic
985575533 5:671878-671900 AGCCCACCCTTCCCCCGGGCTGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986871202 5:12048832-12048854 GACCCACAGTTCCCCAAGGCTGG - Intergenic
992690366 5:79235940-79235962 AGCCTCCAGTTCCCCGGGGCTGG - Intronic
996430517 5:123371270-123371292 AACTCACAGTTCCACGTGGCTGG + Intronic
996635977 5:125690849-125690871 AACTCACAGTTCCGCGTGGCTGG - Intergenic
997036693 5:130201851-130201873 AACGCACAGTTCCACGTGGCTGG + Intergenic
997689832 5:135820944-135820966 ACCTCACACTTCCCCAGGGCTGG - Intergenic
997730922 5:136174997-136175019 AACTCACAGTTCCACGTGGCTGG + Intronic
998460213 5:142304424-142304446 ACTGCCCAGTTCCCCTGGGCTGG - Intergenic
998695502 5:144633518-144633540 AACCTACAGTTCCACGTGGCTGG - Intergenic
1000045652 5:157519912-157519934 AACCCACAGTTTCCCGGGGGCGG + Exonic
1000498097 5:162011364-162011386 AACTCACAGTTCCACGTGGCTGG + Intergenic
1000728621 5:164802858-164802880 AACTCACAGTTCCACAGGGCTGG + Intergenic
1001700833 5:173705514-173705536 ACCCCAGAGCCCCCCGTGGCTGG - Intergenic
1001904510 5:175460724-175460746 ACTCCCCAGTTCCCCAGGGTGGG - Intergenic
1002832349 6:834243-834265 AACTCACAGTTCCACAGGGCTGG - Intergenic
1003643177 6:7892770-7892792 AACTCACAGTTCCACGTGGCTGG - Intronic
1007178724 6:39913415-39913437 ACCACACAGTTCACCTGGCCGGG + Exonic
1007754862 6:44092834-44092856 ACCCAACAATTCCCAGGAGCTGG + Intergenic
1007765035 6:44155088-44155110 ACCCCTCTTTGCCCCGGGGCCGG - Exonic
1008332586 6:50261536-50261558 AACTCACAGTTCCACGTGGCTGG + Intergenic
1008966987 6:57322629-57322651 GACTCACAGTTCCCCAGGGCTGG - Intronic
1009474772 6:64076686-64076708 GACTCACAGTTCCACGGGGCTGG - Intronic
1010347629 6:74830727-74830749 GGCCCACAGTTCCACGTGGCTGG + Intergenic
1011805971 6:91072734-91072756 ACTCGACAGTTCCACAGGGCTGG - Intergenic
1014067511 6:117144775-117144797 AACTCACAGTTCCACAGGGCTGG + Intergenic
1014646215 6:123976119-123976141 AACTCACAGTTCCACGTGGCTGG - Intronic
1015569311 6:134604791-134604813 ACTCCACAGTTCCCCGCTCCAGG + Intergenic
1016440443 6:144077702-144077724 AACTCACAGTTCCACGTGGCTGG - Intergenic
1017038921 6:150292095-150292117 AACTCACAGTTCCACGTGGCTGG + Intergenic
1018197679 6:161369018-161369040 GCCCCCCAGGTCCCTGGGGCTGG - Intronic
1018473896 6:164121847-164121869 GGCTCACAGTTCCACGGGGCTGG + Intergenic
1018745346 6:166757583-166757605 ACTCCCCAGGTCCCGGGGGCCGG + Intronic
1018950434 6:168375153-168375175 AAGCCACAGGTCCCTGGGGCAGG + Intergenic
1019194174 6:170271673-170271695 ACCCCACTGTTACCAGGAGCTGG + Intergenic
1019670416 7:2275009-2275031 ACCCCACTGTAGACCGGGGCAGG - Intronic
1020550873 7:9602831-9602853 AGCTCACAGTTCCACGTGGCTGG - Intergenic
1020611141 7:10400301-10400323 AACTCACAGTTCCACGTGGCTGG + Intergenic
1020873042 7:13657489-13657511 AACTCACAGTTCCACGCGGCTGG + Intergenic
1020932600 7:14416700-14416722 GACTCACAGTTCCACGGGGCTGG - Intronic
1021868288 7:24979909-24979931 GCTCCCTAGTTCCCCGGGGCCGG + Exonic
1023126951 7:36963820-36963842 AACACACAGTACCCAGGGGCAGG - Intronic
1023505559 7:40896680-40896702 AACTCACAGTTCCATGGGGCTGG - Intergenic
1024449901 7:49527770-49527792 GTCCCACAGTTCCACAGGGCTGG + Intergenic
1026171111 7:67954747-67954769 GACCCACAGTTCCACGTGGCTGG + Intergenic
1026537627 7:71253228-71253250 GACTCACAGTTCCCCGTGGCTGG + Intronic
1027138302 7:75639496-75639518 TCCCCAGAGTTCCCGGTGGCGGG + Intronic
1032086598 7:128887001-128887023 ACTGCACATTTCCCCAGGGCTGG + Intronic
1033343877 7:140512520-140512542 AGTCCACATTTCCCCAGGGCAGG + Intergenic
1034274889 7:149819708-149819730 TTCCCACAGTGCCCGGGGGCTGG + Intergenic
1034683739 7:152951404-152951426 AACTCACAGTTCCACGTGGCTGG - Intergenic
1036455368 8:8902149-8902171 AACTCACAGTTCCACGTGGCTGG + Intergenic
1037595009 8:20347750-20347772 GCCTCACAGTTCCACGTGGCTGG + Intergenic
1037733400 8:21548182-21548204 GACTCACAGTTCCACGGGGCGGG + Intergenic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1038018755 8:23535697-23535719 GACCCACAGTTCCACGTGGCTGG + Intronic
1039350663 8:36760289-36760311 AACTCACAGTTCCACAGGGCTGG - Intergenic
1039796302 8:40918420-40918442 ACCCCACAGGTCCCTAAGGCGGG + Intergenic
1039858685 8:41437919-41437941 GACCCACAGTTCCACGTGGCTGG - Intergenic
1042294890 8:67207907-67207929 ACCCCACAGCTCACAGTGGCAGG + Intronic
1043633199 8:82363161-82363183 AACTCACAGTTCCACGTGGCTGG + Intergenic
1043940296 8:86189223-86189245 AACTCACAGTTCCACAGGGCTGG + Intergenic
1044319378 8:90785364-90785386 ACCCCACCAATCCCCCGGGCTGG - Intronic
1046144593 8:110141531-110141553 AACTCACAGTTCCACGTGGCTGG - Intergenic
1047026149 8:120826652-120826674 AACTCACAGTTCCACGTGGCTGG - Intergenic
1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG + Intronic
1049220016 8:141424870-141424892 TCCCCTCAGTCCCCTGGGGCAGG - Intronic
1049478267 8:142806898-142806920 ACCCCACAGTCCCCCAGGCCTGG - Intergenic
1051659183 9:19409638-19409660 CCCCCGCAGGTCCCCGCGGCTGG + Intronic
1053050600 9:34958183-34958205 ACGCCGCAGCCCCCCGGGGCGGG + Intronic
1056293353 9:85166636-85166658 ACCCCACGTTTCTCAGGGGCAGG + Intergenic
1056822184 9:89851073-89851095 GCCCCACAGACCCCAGGGGCAGG + Intergenic
1058111874 9:101039625-101039647 AACTCACAGTTCCACGTGGCTGG + Intronic
1060476115 9:123988073-123988095 ACACCACAGCTGCCCGGGGCTGG - Intergenic
1060742943 9:126111487-126111509 AACTCACAGTTCCACGTGGCTGG - Intergenic
1061191833 9:129086621-129086643 TCCCCACCATTGCCCGGGGCTGG - Intronic
1061208864 9:129179235-129179257 ACCACACAGTTCCCAGGGGGCGG + Intergenic
1061407906 9:130402916-130402938 ACCCCAGAGTTCCTAGGGCCAGG + Intronic
1062188312 9:135230332-135230354 ACCCCACAGGCCCCTGGAGCGGG + Intergenic
1062426978 9:136510589-136510611 AGGCCTCAGTTCCCCCGGGCAGG - Intronic
1062502334 9:136856925-136856947 ACCCCACAGACCCCCTGGCCTGG + Exonic
1185604842 X:1362669-1362691 ACCCCAGAGTCCCCAGGAGCTGG - Intronic
1186039446 X:5460319-5460341 AACTCACAGTTCCACAGGGCTGG + Intergenic
1186066973 X:5776763-5776785 AACTCACAGTTCCACGTGGCTGG + Intergenic
1187306444 X:18099257-18099279 AACCCTCAGTTCTCCAGGGCTGG - Intergenic
1189382346 X:40511000-40511022 AACTCACAGTTCCATGGGGCTGG - Intergenic
1198673819 X:139110565-139110587 AACTCACAGTTCCACGTGGCTGG - Intronic
1199721757 X:150547517-150547539 ATCCCAGAATTCCCCTGGGCAGG + Intergenic
1200112880 X:153751494-153751516 AACTCACACTTCCCCGGGGCAGG + Intergenic
1201509022 Y:14736817-14736839 AACCCACAGTTCCACAGGGCTGG - Intronic
1201547516 Y:15181697-15181719 AACTCACAGTTCCACAGGGCTGG - Intergenic