ID: 1037915436

View in Genome Browser
Species Human (GRCh38)
Location 8:22770124-22770146
Sequence GTGGAAGCCCACAGGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037915421_1037915436 19 Left 1037915421 8:22770082-22770104 CCTAGGCAGCCATCAGCCCCTAG 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1037915436 8:22770124-22770146 GTGGAAGCCCACAGGGTACCAGG No data
1037915426_1037915436 2 Left 1037915426 8:22770099-22770121 CCCTAGGAAGCAGGCGCCCCTCT 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1037915436 8:22770124-22770146 GTGGAAGCCCACAGGGTACCAGG No data
1037915427_1037915436 1 Left 1037915427 8:22770100-22770122 CCTAGGAAGCAGGCGCCCCTCTG 0: 1
1: 0
2: 2
3: 11
4: 185
Right 1037915436 8:22770124-22770146 GTGGAAGCCCACAGGGTACCAGG No data
1037915425_1037915436 3 Left 1037915425 8:22770098-22770120 CCCCTAGGAAGCAGGCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1037915436 8:22770124-22770146 GTGGAAGCCCACAGGGTACCAGG No data
1037915424_1037915436 10 Left 1037915424 8:22770091-22770113 CCATCAGCCCCTAGGAAGCAGGC 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1037915436 8:22770124-22770146 GTGGAAGCCCACAGGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037915436 Original CRISPR GTGGAAGCCCACAGGGTACC AGG Intronic
No off target data available for this crispr