ID: 1037917853

View in Genome Browser
Species Human (GRCh38)
Location 8:22783485-22783507
Sequence CACCGCCATAAGAAAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037917853_1037917863 28 Left 1037917853 8:22783485-22783507 CCAGTGGCTTTCTTATGGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1037917863 8:22783536-22783558 TCTGGGTGGAACCAGATTCCAGG No data
1037917853_1037917856 -3 Left 1037917853 8:22783485-22783507 CCAGTGGCTTTCTTATGGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1037917856 8:22783505-22783527 GTGGCCAGGTGCTCAGTGAGAGG No data
1037917853_1037917859 10 Left 1037917853 8:22783485-22783507 CCAGTGGCTTTCTTATGGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1037917859 8:22783518-22783540 CAGTGAGAGGCCTGAGGCTCTGG No data
1037917853_1037917858 4 Left 1037917853 8:22783485-22783507 CCAGTGGCTTTCTTATGGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1037917858 8:22783512-22783534 GGTGCTCAGTGAGAGGCCTGAGG No data
1037917853_1037917861 14 Left 1037917853 8:22783485-22783507 CCAGTGGCTTTCTTATGGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1037917861 8:22783522-22783544 GAGAGGCCTGAGGCTCTGGGTGG No data
1037917853_1037917860 11 Left 1037917853 8:22783485-22783507 CCAGTGGCTTTCTTATGGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1037917860 8:22783519-22783541 AGTGAGAGGCCTGAGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037917853 Original CRISPR CACCGCCATAAGAAAGCCAC TGG (reversed) Intronic
900005034 1:39554-39576 CTCCTTCATAAGCAAGCCACAGG - Intergenic
914247399 1:145896385-145896407 CACAGCCATAACACAGACACAGG + Intronic
917932653 1:179833926-179833948 CACCCTCATACCAAAGCCACTGG - Intergenic
920788115 1:209062364-209062386 CTCCGGCATAAGAAATCCAGAGG + Intergenic
923071463 1:230568678-230568700 CACTGCCAAAAAAAAGACACAGG - Intergenic
1063350374 10:5348686-5348708 CACTCCTATAATAAAGCCACTGG + Intergenic
1073149012 10:101299008-101299030 CACCCCCAGAAGGAAGCCAGAGG - Intergenic
1078168019 11:8907319-8907341 CCACGCCAAATGAAAGCCACTGG - Intronic
1078461055 11:11515651-11515673 CACCGCCATCAGAGAGCCCGTGG - Intronic
1079115376 11:17637472-17637494 CAGCTCCAAAAGAAAGCAACTGG - Intronic
1079127341 11:17727428-17727450 CACCCCCAAAAGAAACCCATAGG + Intergenic
1080030427 11:27655158-27655180 AATCGCCATAAAAAAGCAACAGG + Exonic
1083797990 11:65029141-65029163 CAACGACACAAAAAAGCCACTGG - Intronic
1084642269 11:70433010-70433032 CACAGCCAGCAGAAACCCACGGG - Intronic
1089756538 11:120691693-120691715 CCATGCCAGAAGAAAGCCACTGG - Intronic
1091379016 12:43733-43755 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1097079202 12:56417350-56417372 CACCTCCAAGAGAAAGCCAAAGG + Exonic
1098267327 12:68735871-68735893 AAGTGCCATAAGAAAGGCACAGG + Intronic
1108498187 13:51045182-51045204 CAGCGCCATGTGAAAGCCATGGG + Intergenic
1108766329 13:53634585-53634607 CAAGGCCAGAAGAAAGCCACAGG + Intergenic
1113005287 13:105694863-105694885 CACTACCATAAGAAAAGCACAGG - Intergenic
1122329533 14:100903337-100903359 CACCGGCATCACTAAGCCACCGG - Intergenic
1130407488 15:83614668-83614690 CACTGCCATAGGAAGGCAACAGG + Intronic
1131536488 15:93241838-93241860 CACCCCCAGAAGAAAACCCCGGG - Intergenic
1132448478 15:101951390-101951412 CTCCTTCATAAGCAAGCCACAGG + Intergenic
1135894502 16:26386638-26386660 CACGGCCATATTAAACCCACTGG - Intergenic
1152786534 17:82250917-82250939 CACCGCATCAAGAAAGCCACAGG + Intronic
1154337334 18:13476142-13476164 CCCTTCCATAAGGAAGCCACAGG - Intronic
1160636787 19:81163-81185 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1160765792 19:807091-807113 CACCGCCTTGAGGAAGTCACAGG - Intronic
1162172798 19:8804653-8804675 CACAGCCATAAAAATGCCAGAGG - Intergenic
1163260400 19:16186074-16186096 CACGGAAATAAGAAAGTCACTGG - Intronic
1164369797 19:27634691-27634713 CTCTCCCATAAGAATGCCACAGG + Intergenic
1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG + Intergenic
1167118651 19:47503287-47503309 CTCCGGCATCGGAAAGCCACTGG - Intronic
926088803 2:10036788-10036810 CAGCCCCAGAAGAAAGCCTCAGG - Intergenic
928016452 2:27662682-27662704 CACAGCCATAAGAAATAGACGGG - Intronic
929023919 2:37580571-37580593 CACAGGCATAAGAAAGGCAAAGG - Intergenic
930559781 2:52947082-52947104 CACCCCTTTAAGTAAGCCACTGG - Intergenic
935230873 2:101094728-101094750 AGCAGCCATCAGAAAGCCACAGG + Intronic
938427736 2:131206198-131206220 CAACACAAAAAGAAAGCCACAGG + Intronic
939327828 2:140717609-140717631 CACAGCCACCAGAAAGACACTGG + Intronic
940243230 2:151586065-151586087 CAAGGCCATAAGAAAGACAAAGG - Intronic
940244186 2:151596618-151596640 CAAGGCCATAAGAAAGACAAAGG - Intronic
941644541 2:168025839-168025861 CACTGCCATAGGAAGGCCCCGGG - Intronic
942062044 2:172236393-172236415 CACCACCATAATCAAGACACAGG + Intergenic
944025828 2:195166266-195166288 CACCCATATAAGAAAGCCAATGG + Intergenic
947071796 2:226296087-226296109 CACCCCCACAAGAAAGTCATTGG + Intergenic
1176999740 21:15597362-15597384 CAAAGGCATAAGAATGCCACAGG - Intergenic
1181857096 22:25789762-25789784 CACCACCCTGAGAAACCCACTGG + Intronic
949454062 3:4219711-4219733 TACCTCCATAAGAAATACACTGG + Intronic
950285020 3:11737869-11737891 CATGGCAATAAGAAAACCACAGG - Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
955131479 3:56173624-56173646 CACAGACATAAACAAGCCACAGG + Intronic
957954290 3:87163897-87163919 CACTGTCATAAGAAAAGCACGGG + Intergenic
961615387 3:128175308-128175330 CACCTCCCTTAGAAAGCAACAGG - Intronic
971260449 4:25052166-25052188 CACTACCATAAGAATGGCACAGG - Intergenic
973714238 4:53659170-53659192 CATCGCCATGAAAAAGCAACTGG + Intronic
974070362 4:57118002-57118024 CCCTGCTGTAAGAAAGCCACAGG - Intergenic
977042975 4:92037517-92037539 CACACCCATGACAAAGCCACAGG + Intergenic
979544263 4:121921697-121921719 CACAGCCATATGCAAGCCATTGG - Intronic
980675687 4:136076847-136076869 CACCACAATAAAAAAGGCACAGG - Intergenic
986053434 5:4111993-4112015 GGCTGCCATAAGAAAGTCACAGG + Intergenic
988256352 5:28824169-28824191 CACTGCCACAAGAAAGTGACAGG - Intergenic
988974797 5:36504399-36504421 GACTCCCATAAGAAAGCCATAGG + Intergenic
990533858 5:56700807-56700829 CACAGCCATCAGAAATCCCCAGG + Intergenic
994326937 5:98459094-98459116 CACCACCACCAGAAAACCACTGG + Intergenic
998005533 5:138654499-138654521 CACCGCCACAAGACAGGCAGAGG + Intronic
1003970512 6:11294922-11294944 CACTGCCATAAGAACAGCACGGG - Intronic
1007325288 6:41054771-41054793 TCCTTCCATAAGAAAGCCACTGG - Intronic
1010454905 6:76043752-76043774 CACCTCCAAAGGAAAGCCAGAGG + Intronic
1010701477 6:79053530-79053552 CAGCTCCATAAGGAAGCCTCGGG - Intronic
1011889341 6:92137669-92137691 TACTGCAATGAGAAAGCCACAGG + Intergenic
1012707059 6:102545152-102545174 TACAGCAATAAGAAAACCACTGG - Intergenic
1018956069 6:168411357-168411379 CACGCCCATCACAAAGCCACGGG + Intergenic
1024500213 7:50097226-50097248 CACCTCCAAAGGAAAGCCACAGG + Intronic
1031212378 7:118846961-118846983 CACTCCCATCAGAAAGTCACAGG + Intergenic
1035183068 7:157104933-157104955 CACCTCCAAAGGGAAGCCACAGG - Intergenic
1037917853 8:22783485-22783507 CACCGCCATAAGAAAGCCACTGG - Intronic
1038712548 8:29961287-29961309 CACAGCCATCAGACAGCCATAGG + Intergenic
1042169186 8:65975763-65975785 CACCCGCCTAAGAGAGCCACAGG + Intergenic
1049092562 8:140527530-140527552 CACCCCCATGACAAAGTCACAGG + Intergenic
1049887728 9:39336-39358 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1051361948 9:16288888-16288910 CACCTCCACAAGGAAGCAACAGG + Intergenic
1055351776 9:75396574-75396596 CACTGCCACAGGAAAGCCTCTGG + Intergenic
1062549501 9:137079422-137079444 GACCGCCTTAAGGAAGCCTCGGG - Exonic
1186649868 X:11547715-11547737 CACCTCAATAAAAAAGGCACAGG + Intronic
1190260588 X:48794369-48794391 CACTGTCATCAGAGAGCCACAGG - Intergenic
1191643442 X:63452696-63452718 CACCTCCCTAGGAGAGCCACTGG - Intergenic
1196157974 X:112451937-112451959 CACCGGCATCAGAAATCAACAGG + Intergenic
1196998462 X:121410520-121410542 CACCACCAGAAGAAAGCAAAAGG - Intergenic