ID: 1037922464

View in Genome Browser
Species Human (GRCh38)
Location 8:22817041-22817063
Sequence TTTGAGGACCCTCCCTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037922456_1037922464 16 Left 1037922456 8:22817002-22817024 CCTTTCCCTCCCACATAATGGCA 0: 1
1: 0
2: 2
3: 12
4: 226
Right 1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG No data
1037922460_1037922464 6 Left 1037922460 8:22817012-22817034 CCACATAATGGCACAAACAAGCC 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG No data
1037922457_1037922464 11 Left 1037922457 8:22817007-22817029 CCCTCCCACATAATGGCACAAAC 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG No data
1037922459_1037922464 7 Left 1037922459 8:22817011-22817033 CCCACATAATGGCACAAACAAGC 0: 1
1: 0
2: 0
3: 3
4: 124
Right 1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG No data
1037922458_1037922464 10 Left 1037922458 8:22817008-22817030 CCTCCCACATAATGGCACAAACA 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037922464 Original CRISPR TTTGAGGACCCTCCCTGAAG AGG Intronic
No off target data available for this crispr