ID: 1037924572

View in Genome Browser
Species Human (GRCh38)
Location 8:22834226-22834248
Sequence TTTCCCATACAGAACTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037924572_1037924579 7 Left 1037924572 8:22834226-22834248 CCCACCAAGTTCTGTATGGGAAA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1037924579 8:22834256-22834278 AAGAGCCTTCTTCCTGGGGGAGG No data
1037924572_1037924575 1 Left 1037924572 8:22834226-22834248 CCCACCAAGTTCTGTATGGGAAA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1037924575 8:22834250-22834272 CTAGTTAAGAGCCTTCTTCCTGG No data
1037924572_1037924577 3 Left 1037924572 8:22834226-22834248 CCCACCAAGTTCTGTATGGGAAA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1037924577 8:22834252-22834274 AGTTAAGAGCCTTCTTCCTGGGG No data
1037924572_1037924578 4 Left 1037924572 8:22834226-22834248 CCCACCAAGTTCTGTATGGGAAA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1037924578 8:22834253-22834275 GTTAAGAGCCTTCTTCCTGGGGG No data
1037924572_1037924576 2 Left 1037924572 8:22834226-22834248 CCCACCAAGTTCTGTATGGGAAA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1037924576 8:22834251-22834273 TAGTTAAGAGCCTTCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037924572 Original CRISPR TTTCCCATACAGAACTTGGT GGG (reversed) Intronic
907886516 1:58597136-58597158 TTTCCCATGCAGCCCTTGGAGGG - Intergenic
911170925 1:94770184-94770206 TTTCCACTTCAGAACTTTGTGGG - Intergenic
912201082 1:107458780-107458802 TTTTGCATACAAAAATTGGTAGG + Intronic
913444692 1:118938258-118938280 TTTCCCAAATAGAACTTGGAGGG - Intronic
916354629 1:163890933-163890955 TTCCCCATACATATCATGGTAGG - Intergenic
916514576 1:165503913-165503935 TTTCCCAGTCAGTAATTGGTGGG - Intergenic
917524720 1:175777809-175777831 TTTCCCATTCAGTACATTGTTGG - Intergenic
917605303 1:176622381-176622403 TATAGCATACAGAACATGGTAGG + Intronic
920792834 1:209108828-209108850 TTTCCCATACAGTAATGGGCAGG + Intergenic
923226327 1:231941885-231941907 TTTCCCCTACAGTTCTTGGCTGG - Intronic
1065264686 10:23962697-23962719 TTGCCCACACAGAACTGGATGGG + Intronic
1068739775 10:60455950-60455972 TTGGTCACACAGAACTTGGTTGG - Intronic
1070747349 10:78942184-78942206 TTTTCAGTACACAACTTGGTGGG - Intergenic
1071973410 10:90930878-90930900 TTTACCATACAGAACTTATCTGG - Intergenic
1079014815 11:16859636-16859658 TTTCCCATTAAGAGCCTGGTGGG + Intronic
1079645811 11:22862816-22862838 TTTTCCATACAAAATATGGTAGG - Intergenic
1084365327 11:68693779-68693801 CTTCCCAGAGAGAACGTGGTTGG + Intergenic
1086023433 11:82260509-82260531 TTTCCAATACAGAAGTAGGAAGG - Intergenic
1088498915 11:110462342-110462364 TTTTCCATACAGATCACGGTTGG + Exonic
1097090144 12:56498389-56498411 TTTACAATTCAGGACTTGGTGGG - Intergenic
1100482470 12:94992539-94992561 TTTCTCATGTAGAACTTGGGTGG + Intronic
1103792353 12:123480703-123480725 TTTCTCATGCAGTGCTTGGTAGG - Intronic
1104172614 12:126296933-126296955 TATCACATACATAAGTTGGTGGG - Intergenic
1106861626 13:33915634-33915656 TTTCCCAGTCAGAATTGGGTAGG + Intronic
1109463099 13:62690102-62690124 TTTACCAAACATAACTTGGTAGG + Intergenic
1110795510 13:79632337-79632359 TTTTCCAATCAGCACTTGGTGGG - Intergenic
1117659120 14:57985936-57985958 TTTTCCACACAGAACTTTGTGGG + Intergenic
1119850687 14:77864485-77864507 TGTCCCATGGAGAACTTGATGGG + Intronic
1124349054 15:28942411-28942433 TTTCCCATAAGGAACTGTGTTGG + Intronic
1125983534 15:44026675-44026697 TTTCTCAAACAGAAAATGGTGGG + Intronic
1127081961 15:55389565-55389587 TTTACCATACAGAACATGACAGG + Intronic
1129032467 15:72629050-72629072 TTTCCCATATAGACCAAGGTAGG - Intergenic
1130658035 15:85806269-85806291 TTCCCCCTACAGATCTTGGCAGG - Intergenic
1131735796 15:95330786-95330808 TTTCCCAGACACAACATGATTGG + Intergenic
1135913549 16:26582825-26582847 TTTCCCACACAGATGTAGGTAGG + Intergenic
1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG + Intronic
1141163644 16:81645764-81645786 ACTCCTTTACAGAACTTGGTAGG + Intronic
1147835888 17:43331462-43331484 TTTACAATTCAGGACTTGGTGGG - Intergenic
1147837589 17:43345713-43345735 TTTACAATTCAGGACTTGGTGGG - Intergenic
1149215455 17:54348504-54348526 TTTTGCATACAAAGCTTGGTGGG + Intergenic
1151165354 17:72198608-72198630 TTTCCCCTTCGGAACTTGGATGG - Intergenic
1154055358 18:11008124-11008146 TTTCCCATCAATCACTTGGTGGG + Intronic
1156678884 18:39565569-39565591 ATTACCATAGAAAACTTGGTGGG + Intergenic
1157567784 18:48691397-48691419 TTTCCCATACATAACTTTGTAGG + Intronic
1163896816 19:20066667-20066689 TTTCCCACACAGAACATTTTTGG + Intergenic
1163935796 19:20441912-20441934 TTTCCCACACAGAACATTTTTGG - Intergenic
1163969050 19:20774810-20774832 TTTCCCATACAGAACATTTTTGG - Intronic
1164084307 19:21887626-21887648 TTTACAATTCAGGACTTGGTGGG - Intergenic
1164580312 19:29430711-29430733 GTTCCCATACAGGGCTGGGTTGG + Intergenic
1166908583 19:46133887-46133909 TTTCCCAGACAAAACTTCATTGG + Intergenic
1167806695 19:51791607-51791629 TTTCCCATACAAATCTGGGGAGG + Intronic
1168568570 19:57444719-57444741 TTTCTCATGCTGAACTAGGTGGG - Exonic
929482446 2:42323489-42323511 TTTCCCATACAGCACTATGGTGG + Intronic
931467103 2:62499379-62499401 TTTCCCAGATAGGACTAGGTAGG - Intergenic
934034681 2:88079021-88079043 TTTCCCATGGTGAACTTGGATGG - Intronic
936281745 2:111147255-111147277 TTTCCCAACCAGACCCTGGTGGG - Intronic
937964972 2:127498796-127498818 TTTTCCATCCAGAGATTGGTGGG - Intronic
940051125 2:149466133-149466155 TTTCCCAAGTAGAACTAGGTGGG - Intronic
941133341 2:161682127-161682149 TTTCCCAAAAAGTATTTGGTGGG - Intronic
942396141 2:175551706-175551728 TTTCCCACATAGAACTTCCTTGG - Intergenic
944219801 2:197291576-197291598 TTTCTCATGCAGAATTTGGCTGG - Intronic
946105238 2:217363426-217363448 TTTCCCATGCAAAACTAAGTGGG - Intronic
1172978498 20:38923955-38923977 TGTCCCACACAGAACTTTGTTGG + Intergenic
1174244847 20:49170766-49170788 TTTCCCAGACACATCTTGTTTGG - Intronic
1177848175 21:26316177-26316199 TCTCCCATACAGAACTCCGCTGG + Intergenic
1182256682 22:29044113-29044135 TTTCCCATACACAACATAGCCGG + Intronic
949811211 3:8008277-8008299 TTTCCCTCACAGAGATTGGTTGG - Intergenic
950932760 3:16807351-16807373 TTTGTCATCTAGAACTTGGTAGG + Intronic
951567418 3:24024848-24024870 TTTCCCATGCATAAATTGTTGGG + Intergenic
953283521 3:41581698-41581720 TTTCCCATCCAGGGCATGGTAGG + Intronic
954645073 3:52126282-52126304 TTTCCCTCCCAGAACTTGGCTGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955714350 3:61813032-61813054 TTTCCCAAACAACAATTGGTGGG - Intronic
958185557 3:90115244-90115266 TTTCCAACACAGAACTTTGGGGG - Intergenic
961513505 3:127419012-127419034 TTCCCCATGCAGAACTTAGCTGG + Intergenic
965641186 3:170830462-170830484 TTTCCCATACAGAAATTGTTAGG + Intronic
968220231 3:196932247-196932269 TTTCTCATACATACATTGGTTGG - Exonic
973058148 4:45686379-45686401 TTTCCCACACAAAACTTGTTTGG - Intergenic
973827932 4:54727681-54727703 TTTGCCATAGAGAACATCGTAGG + Intronic
976559810 4:86488445-86488467 TTTCCCATCCAGATATTGGGAGG + Intronic
980789933 4:137607515-137607537 TTTCCCTTAAAAGACTTGGTTGG - Intergenic
981038225 4:140194581-140194603 TTTCACAGACAGAGCTTAGTCGG - Intergenic
981689513 4:147491685-147491707 TATCACATACGGAATTTGGTGGG - Intronic
982519283 4:156393074-156393096 TTTACCATACAGAACTCTCTTGG - Intergenic
986047805 5:4057360-4057382 TTTCCCATTCAGTACTATGTTGG - Intergenic
988484722 5:31659048-31659070 TTTTCCATACTGACTTTGGTTGG + Intronic
989519940 5:42389785-42389807 TCTTCCTAACAGAACTTGGTTGG - Intergenic
989811022 5:45675314-45675336 TTACCCATACAAACCTTTGTTGG + Intronic
993259099 5:85635508-85635530 TTTCTCATACTGATCTTGTTTGG - Intergenic
993441788 5:87965602-87965624 TTGCCAATACAGAAATTGTTTGG - Intergenic
993468870 5:88282198-88282220 CTTCTCATACTGTACTTGGTTGG - Intergenic
993848470 5:92974982-92975004 TTTCACATTCAGCACTTGTTTGG + Intergenic
994007792 5:94860564-94860586 ATTCCCATACGGAACTTGTCTGG - Intronic
994795431 5:104293015-104293037 TTGCCCATTTAGAACGTGGTTGG - Intergenic
996292347 5:121866948-121866970 CTTCCAATACAGATCTTAGTGGG + Intergenic
996886688 5:128364023-128364045 TTTCCCATAAAGCACTTGAGTGG - Intronic
997417301 5:133738925-133738947 CTTTCCATCCAGAACTTTGTAGG + Intergenic
1000764767 5:165273385-165273407 TTTCCAACTCAGAACTTGCTAGG - Intergenic
1000770668 5:165349623-165349645 TTCCCTATATAAAACTTGGTTGG + Intergenic
1003908935 6:10726199-10726221 TTTTACATACAGAACATGGAAGG + Intronic
1003968131 6:11272855-11272877 TTACCCATACAGATATTGGGTGG + Intronic
1004661964 6:17718592-17718614 TTTCCCCTCCTCAACTTGGTGGG + Intergenic
1005197697 6:23308735-23308757 CTTCCATTCCAGAACTTGGTTGG - Intergenic
1007462212 6:42026920-42026942 TCTCCCATACAGATCCGGGTGGG - Intronic
1009419798 6:63452940-63452962 TGACCCAAACAGCACTTGGTTGG - Intergenic
1010336908 6:74696009-74696031 TTTCCCATTCATGACTTTGTTGG - Intergenic
1010698028 6:79002574-79002596 TTTCCTATACAGTAATGGGTGGG - Intronic
1013904129 6:115195296-115195318 GTTCCCATAAAGTACTAGGTGGG - Intergenic
1016508860 6:144817097-144817119 TTTTCCTTACTGAACTTGGTTGG + Intronic
1019455686 7:1125952-1125974 TTTAACACTCAGAACTTGGTGGG + Intronic
1020762857 7:12289828-12289850 TTTCACACCCACAACTTGGTAGG - Intergenic
1020858911 7:13463370-13463392 TTTCCCATACAGGACTCCTTGGG + Intergenic
1026384938 7:69837374-69837396 TTACCCAGCTAGAACTTGGTAGG + Intronic
1028214169 7:88111442-88111464 TTTCCCATAAAGAACCTGCAAGG + Intronic
1028484603 7:91344033-91344055 GTTCCCACATAGACCTTGGTGGG - Intergenic
1032243435 7:130185713-130185735 TTTCAAATAAAGAACTTGCTTGG - Intronic
1032604960 7:133340115-133340137 TTTCCCATTCAGAATTATGTTGG + Intronic
1037924572 8:22834226-22834248 TTTCCCATACAGAACTTGGTGGG - Intronic
1039219281 8:35310664-35310686 TTTGCCTTACAGAGCTTTGTAGG - Intronic
1045843374 8:106605424-106605446 TTTCCCCTACAGAATGTGGTTGG - Intronic
1048370219 8:133770720-133770742 TTTACCATGCATAGCTTGGTGGG + Intergenic
1049880515 8:145059013-145059035 TTTACAATTCAGGACTTGGTGGG + Intergenic
1052454030 9:28671084-28671106 TTTCCCATACACAAATATGTAGG + Intergenic
1054452352 9:65409969-65409991 TTTCTCTTACAGAAAGTGGTCGG - Intergenic
1055167622 9:73216809-73216831 TTTCCCAAATAGAGCTTTGTTGG + Intergenic
1055261685 9:74444067-74444089 TTTCCCATCCAGAAATTAGTAGG + Intergenic
1056934321 9:90904152-90904174 TTTACAATTCAGGACTTGGTGGG + Intergenic
1059110562 9:111555199-111555221 TTTGCCAAATAGAACTTGATAGG - Intronic
1185871508 X:3668656-3668678 TTTCTTCTACAGAACTTGGAAGG - Intronic
1186189212 X:7052708-7052730 TTTCACAGAGGGAACTTGGTTGG + Intronic
1186588786 X:10905599-10905621 TTTAAAATATAGAACTTGGTTGG - Intergenic
1187406983 X:19013275-19013297 TTTCTCCTACAAAAGTTGGTTGG - Intronic
1188291430 X:28393395-28393417 CTTTGCATACATAACTTGGTTGG + Intergenic
1191892019 X:65953794-65953816 TTTCCCATTCAGAATTATGTTGG + Intergenic
1192671752 X:73151646-73151668 TTTCCCATTCAGTATTTTGTAGG + Intergenic
1195499190 X:105574416-105574438 TGTCCCATACAGAGCTTGCTTGG - Intronic
1197562977 X:128047333-128047355 TGTTCCATCCACAACTTGGTGGG + Intergenic
1200876609 Y:8162715-8162737 TTTCCACTGCAGAACGTGGTGGG - Intergenic
1202626341 Y:56863010-56863032 CTTCCCATAAAGAAATTTGTAGG + Intergenic