ID: 1037927270

View in Genome Browser
Species Human (GRCh38)
Location 8:22853567-22853589
Sequence AGGTAGGAATAGAGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037927265_1037927270 20 Left 1037927265 8:22853524-22853546 CCTTCTTTTCAGAGAGAGGGTCA 0: 1
1: 0
2: 1
3: 33
4: 340
Right 1037927270 8:22853567-22853589 AGGTAGGAATAGAGGGAACCAGG No data
1037927264_1037927270 21 Left 1037927264 8:22853523-22853545 CCCTTCTTTTCAGAGAGAGGGTC 0: 1
1: 0
2: 9
3: 107
4: 2853
Right 1037927270 8:22853567-22853589 AGGTAGGAATAGAGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037927270 Original CRISPR AGGTAGGAATAGAGGGAACC AGG Intronic
No off target data available for this crispr