ID: 1037927762

View in Genome Browser
Species Human (GRCh38)
Location 8:22857922-22857944
Sequence ACTTACATGCCCCTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037927758_1037927762 7 Left 1037927758 8:22857892-22857914 CCTGCAATAGTAGGAATTGTCCG 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG No data
1037927756_1037927762 19 Left 1037927756 8:22857880-22857902 CCATGAGAACTACCTGCAATAGT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037927762 Original CRISPR ACTTACATGCCCCTGGTGCA TGG Intronic
No off target data available for this crispr