ID: 1037928923

View in Genome Browser
Species Human (GRCh38)
Location 8:22865772-22865794
Sequence AGATCGGCGGCCACTCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037928918_1037928923 -10 Left 1037928918 8:22865759-22865781 CCACGCGGGAAGGAGATCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1037928923 8:22865772-22865794 AGATCGGCGGCCACTCCCGGGGG No data
1037928908_1037928923 20 Left 1037928908 8:22865729-22865751 CCCCACCGGATCTGGTGGGCGGA 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1037928923 8:22865772-22865794 AGATCGGCGGCCACTCCCGGGGG No data
1037928910_1037928923 18 Left 1037928910 8:22865731-22865753 CCACCGGATCTGGTGGGCGGAAG 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1037928923 8:22865772-22865794 AGATCGGCGGCCACTCCCGGGGG No data
1037928911_1037928923 15 Left 1037928911 8:22865734-22865756 CCGGATCTGGTGGGCGGAAGATG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1037928923 8:22865772-22865794 AGATCGGCGGCCACTCCCGGGGG No data
1037928909_1037928923 19 Left 1037928909 8:22865730-22865752 CCCACCGGATCTGGTGGGCGGAA 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1037928923 8:22865772-22865794 AGATCGGCGGCCACTCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037928923 Original CRISPR AGATCGGCGGCCACTCCCGG GGG Intronic
No off target data available for this crispr