ID: 1037928926 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:22865784-22865806 |
| Sequence | ACTCCCGGGGGCGCGAGCGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037928911_1037928926 | 27 | Left | 1037928911 | 8:22865734-22865756 | CCGGATCTGGTGGGCGGAAGATG | No data | ||
| Right | 1037928926 | 8:22865784-22865806 | ACTCCCGGGGGCGCGAGCGGCGG | No data | ||||
| 1037928910_1037928926 | 30 | Left | 1037928910 | 8:22865731-22865753 | CCACCGGATCTGGTGGGCGGAAG | No data | ||
| Right | 1037928926 | 8:22865784-22865806 | ACTCCCGGGGGCGCGAGCGGCGG | No data | ||||
| 1037928918_1037928926 | 2 | Left | 1037928918 | 8:22865759-22865781 | CCACGCGGGAAGGAGATCGGCGG | No data | ||
| Right | 1037928926 | 8:22865784-22865806 | ACTCCCGGGGGCGCGAGCGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037928926 | Original CRISPR | ACTCCCGGGGGCGCGAGCGG CGG | Intronic | ||