ID: 1037928926

View in Genome Browser
Species Human (GRCh38)
Location 8:22865784-22865806
Sequence ACTCCCGGGGGCGCGAGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037928911_1037928926 27 Left 1037928911 8:22865734-22865756 CCGGATCTGGTGGGCGGAAGATG No data
Right 1037928926 8:22865784-22865806 ACTCCCGGGGGCGCGAGCGGCGG No data
1037928910_1037928926 30 Left 1037928910 8:22865731-22865753 CCACCGGATCTGGTGGGCGGAAG No data
Right 1037928926 8:22865784-22865806 ACTCCCGGGGGCGCGAGCGGCGG No data
1037928918_1037928926 2 Left 1037928918 8:22865759-22865781 CCACGCGGGAAGGAGATCGGCGG No data
Right 1037928926 8:22865784-22865806 ACTCCCGGGGGCGCGAGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037928926 Original CRISPR ACTCCCGGGGGCGCGAGCGG CGG Intronic