ID: 1037929054

View in Genome Browser
Species Human (GRCh38)
Location 8:22866576-22866598
Sequence TTTAGTATAGTGGTTATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 246}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037929054_1037929065 24 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929065 8:22866623-22866645 TAGCCTTAAGGGGGTGGGGTGGG No data
1037929054_1037929060 15 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929060 8:22866614-22866636 TTAACTATATAGCCTTAAGGGGG No data
1037929054_1037929062 19 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929062 8:22866618-22866640 CTATATAGCCTTAAGGGGGTGGG No data
1037929054_1037929061 18 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929061 8:22866617-22866639 ACTATATAGCCTTAAGGGGGTGG No data
1037929054_1037929058 13 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929058 8:22866612-22866634 GCTTAACTATATAGCCTTAAGGG No data
1037929054_1037929059 14 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929059 8:22866613-22866635 CTTAACTATATAGCCTTAAGGGG No data
1037929054_1037929069 27 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929069 8:22866626-22866648 CCTTAAGGGGGTGGGGTGGGGGG No data
1037929054_1037929063 20 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929063 8:22866619-22866641 TATATAGCCTTAAGGGGGTGGGG No data
1037929054_1037929067 26 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929067 8:22866625-22866647 GCCTTAAGGGGGTGGGGTGGGGG No data
1037929054_1037929057 12 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929057 8:22866611-22866633 TGCTTAACTATATAGCCTTAAGG No data
1037929054_1037929064 23 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929064 8:22866622-22866644 ATAGCCTTAAGGGGGTGGGGTGG No data
1037929054_1037929066 25 Left 1037929054 8:22866576-22866598 CCACACATAACCACTATACTAAA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1037929066 8:22866624-22866646 AGCCTTAAGGGGGTGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037929054 Original CRISPR TTTAGTATAGTGGTTATGTG TGG (reversed) Intronic
901747447 1:11383715-11383737 TTTAGTACAGTGGTTTGGTTTGG + Intergenic
905844658 1:41218790-41218812 TTTAGTGTAGTGGTTAAGAGTGG - Intronic
906094861 1:43215951-43215973 TTTGGTATAGTGATTAAGGGAGG - Intronic
906219900 1:44070250-44070272 TTTTGTATAGTGGTGAAGTCAGG + Intergenic
906872310 1:49496543-49496565 GTTAGTATAGTGGTTACTAGGGG - Intronic
907019595 1:51053944-51053966 TTTTGTATAGTGTTTTTGTCTGG + Intergenic
907338748 1:53718569-53718591 TTCAGCATGGTGGTTATGTTTGG - Intronic
907590051 1:55657934-55657956 TTTTGAATAGTGGGAATGTGAGG + Intergenic
907841735 1:58164876-58164898 TTTAGAATAGGGGTTAGGTCTGG + Intronic
908055013 1:60276424-60276446 TTTAGTTTAGTTGCTATGTGTGG - Intergenic
908777402 1:67653845-67653867 TTTAGGATAGTGGTTACCTTTGG - Intergenic
909697217 1:78481281-78481303 TTCAGGATAGTGGTTATCTGGGG + Intronic
909888531 1:80973361-80973383 TTCAGTATAGTGGTAATGCCTGG - Intergenic
909940810 1:81609525-81609547 TTTAATAAAGTTCTTATGTGTGG - Intronic
913032291 1:114921317-114921339 TTTATTATTGTGTTTATGTCTGG + Intronic
913100807 1:115563016-115563038 TTTACTGTAGTGGTAATGTTTGG - Intergenic
915207097 1:154278211-154278233 TTTAGTACTGTGGTTAAGAGGGG + Intergenic
916153909 1:161825577-161825599 TTTATTATAAAGGATATGTGGGG + Intronic
916206962 1:162324384-162324406 TTTTGTGTAGTGGTTTTGTGAGG + Intronic
916693135 1:167210197-167210219 GTTATGATAATGGTTATGTGTGG - Intergenic
917146069 1:171893024-171893046 TAGAGTACAGTGGTTATGTGTGG + Intronic
917229073 1:172816486-172816508 TTTACTATAGTGAATATGTGAGG + Intergenic
917970442 1:180202582-180202604 TTGAGAATAGTGATTATTTGGGG + Exonic
918436730 1:184521933-184521955 ATTAGTACAGTGCTTATGTATGG - Intronic
918486479 1:185034302-185034324 TTTAGAATAGTGGTTAAGGGTGG + Intergenic
921855489 1:219978259-219978281 TTTAGTATACTAGTTACGTGAGG + Intronic
922635220 1:227162366-227162388 TTTAGGATAGTAGCTATGTCTGG - Intronic
923443556 1:234045179-234045201 TTTAGTACATGGGTTATGTCTGG - Intronic
924035666 1:239934048-239934070 TTTAATCTGGTAGTTATGTGTGG + Intergenic
924574285 1:245265462-245265484 TTTTGTATATAGGATATGTGAGG - Intronic
924692931 1:246369056-246369078 TTTAGTTCAGTGGTTTTGAGAGG - Intronic
1064506121 10:16032260-16032282 ATAAGTCTAGTGGTTTTGTGAGG - Intergenic
1066815704 10:39408382-39408404 TTCTGTCTAGTGTTTATGTGAGG - Intergenic
1066820496 10:39480862-39480884 TTCTGTGTAGTGTTTATGTGAGG + Intergenic
1067075036 10:43173380-43173402 TTGGGTATATAGGTTATGTGTGG + Intronic
1067177903 10:43962955-43962977 ATTAGTGTTGTGGTTATGTAAGG - Intergenic
1068280371 10:54860805-54860827 TCTAATATATTGGTTATTTGTGG + Intronic
1068300873 10:55137334-55137356 TTTACTATACTGATTATTTGAGG - Intronic
1068311413 10:55281389-55281411 ATTTGTATAGTGGTAATGAGGGG - Intronic
1068778939 10:60898691-60898713 TTAAGTACAGATGTTATGTGGGG + Intronic
1069522240 10:69132280-69132302 TTGATTATAGTGGTTTTGTATGG + Intronic
1070938928 10:80325891-80325913 TTTAAGATAATGGTTATATGTGG + Intergenic
1071027973 10:81138427-81138449 TTAAGGTTAGTAGTTATGTGTGG - Intergenic
1072497645 10:95978162-95978184 TTTACTATACTGTATATGTGTGG + Intronic
1072912273 10:99513851-99513873 TTTAGTATATTGATTAATTGGGG - Intergenic
1074842044 10:117364064-117364086 TTTAGTATTTTGTTTGTGTGTGG + Intronic
1077414217 11:2417136-2417158 TTTAGTATATTCGTGAGGTGGGG - Intronic
1079150003 11:17889873-17889895 TTTAGAATAATGGTTATTTTGGG + Intronic
1079709950 11:23669416-23669438 TATAGTAAAGTTGTTAAGTGGGG + Intergenic
1079792955 11:24761918-24761940 TTCAGTATAGTGGTTACCTGGGG + Intronic
1080918568 11:36685654-36685676 TGCATTATAGTGGTAATGTGTGG - Intergenic
1081504164 11:43697613-43697635 TTTAGCATAGTGGCTAAGAGAGG - Intronic
1083873196 11:65504756-65504778 TTTAGTGCATTGTTTATGTGTGG + Intergenic
1084076591 11:66782969-66782991 GTTTGTTTAGTGGTTATTTGAGG + Intronic
1086062668 11:82716133-82716155 TTTAGAATTGTTGTTATATGTGG + Intergenic
1087000551 11:93415648-93415670 GTCAGGATAGTGGTTATGTCGGG - Intronic
1087929345 11:103958637-103958659 TTTATTATTGTGGTTAAGAGAGG + Intronic
1090888629 11:130902202-130902224 TTTTTTATAGTGGTCAAGTGAGG - Intronic
1090945026 11:131421781-131421803 TTTAGCATTGTGATTATTTGGGG + Intronic
1091075458 11:132611658-132611680 TATATTATAGTGGATGTGTGTGG + Intronic
1091350389 11:134889436-134889458 TTCAGTATACTAGTGATGTGAGG - Intergenic
1091475940 12:772890-772912 TTTAGAACAGTGGTACTGTGTGG + Intronic
1091834363 12:3575255-3575277 TTTAGGAGAGTGGGTGTGTGCGG - Intronic
1092561562 12:9619596-9619618 TTTAGTATTGCGGTGAGGTGTGG + Intergenic
1092730369 12:11527242-11527264 TTTAGTATAGTGGCGATGTTTGG + Intergenic
1094417456 12:30232374-30232396 TTAAGTATAGAGTTTATCTGAGG - Intergenic
1094564024 12:31583384-31583406 TTTAGCACAGTGGTTGGGTGGGG + Intronic
1094799386 12:34015044-34015066 TTTAGCATAGTGTTTTTGTTTGG - Intergenic
1095031746 12:37294469-37294491 TTCTGTCTAGTGTTTATGTGAGG - Intergenic
1095064845 12:37758919-37758941 TTTTGTCTAGTTTTTATGTGAGG - Intergenic
1096033989 12:48447608-48447630 TTTAGGATAGTGGTTATGTATGG - Intergenic
1100409611 12:94302234-94302256 TGTAGCACAGTGGGTATGTGGGG - Intronic
1100552455 12:95657974-95657996 CTATGTATAGTGGTTATGCGTGG + Exonic
1101308836 12:103557667-103557689 TTTAGTGTTTTGGGTATGTGGGG - Intergenic
1101341445 12:103845364-103845386 TTGATTATTGTGGTTATATGGGG + Intergenic
1101668155 12:106839508-106839530 AGTAGAATAGTGGTTATCTGGGG + Intronic
1103039638 12:117684573-117684595 CTGTGTAGAGTGGTTATGTGGGG + Intronic
1103228069 12:119305060-119305082 TTTAGCTTAGTGGTTTTGGGGGG + Intergenic
1105831931 13:24170278-24170300 TTTAGAATAATTGTTGTGTGGGG - Intronic
1106353181 13:28954722-28954744 TTTGGTGAAGTGGATATGTGAGG + Intronic
1106673388 13:31931416-31931438 TTGCGTATAGTGGTGATGAGAGG + Intergenic
1107716521 13:43205014-43205036 TTTATTAGTGTGGGTATGTGTGG + Intergenic
1108607443 13:52053749-52053771 TTTGGTATGGAGGGTATGTGGGG - Intronic
1109038480 13:57298271-57298293 TTTATTTTAGTAATTATGTGTGG + Intergenic
1109953159 13:69528717-69528739 TACAGTAAAGTGGTTATTTGAGG - Intergenic
1111522549 13:89425296-89425318 TTTAGTTTAGTTTTCATGTGTGG - Intergenic
1111545993 13:89737073-89737095 ATGAGTATAGTGTTTATTTGGGG - Intergenic
1112160670 13:96864148-96864170 GTTAGGATGGTGGTTATTTGTGG - Intergenic
1112727369 13:102319933-102319955 TGTAGTTCAGTGGTTATTTGGGG - Intronic
1115292722 14:31790904-31790926 TTAAGAATAGTGGTTATCAGGGG - Intronic
1115682875 14:35761321-35761343 TTTAGACTAGTGGTGATGGGAGG - Intronic
1115909638 14:38241239-38241261 TTTAGTATATAGGTATTGTGAGG - Intergenic
1116422575 14:44749870-44749892 GTTAGCATATTGGTTGTGTGGGG - Intergenic
1117406622 14:55410617-55410639 TAAAGTCTAGTGGTTAAGTGCGG + Intronic
1117652058 14:57917602-57917624 AGTAATATAGTGGTAATGTGGGG + Intronic
1117943679 14:60995434-60995456 AGTAGAACAGTGGTTATGTGGGG + Intronic
1118024168 14:61751754-61751776 TTTATTTTGGTGGTTTTGTGGGG + Intergenic
1118299022 14:64598216-64598238 TTTAAATTAGTGGGTATGTGTGG - Intergenic
1118639884 14:67782538-67782560 TTGAGAATACTGGTTATGCGTGG + Intronic
1119051567 14:71374576-71374598 TTTAGTAAAGTGGTCATGCCTGG + Intronic
1121198895 14:92100692-92100714 TTCAGCATAGTGGTTATATTTGG + Intronic
1123228611 15:17077945-17077967 TTCAGTGTAGTTTTTATGTGAGG + Intergenic
1124077323 15:26458675-26458697 TTTAGTATAGAGTTTATCTGAGG - Intergenic
1126029232 15:44479823-44479845 TTCATTATAGTAGTTTTGTGTGG + Intronic
1126286373 15:47017062-47017084 TTTATTACAGTTCTTATGTGAGG - Intergenic
1126720825 15:51577394-51577416 TTTTATATAGTGGTTATGGCAGG - Intronic
1127586688 15:60384505-60384527 TCTAGTATATTTCTTATGTGTGG - Intronic
1128860679 15:71068784-71068806 ATTAGAATAGTAGTTATGGGTGG - Intergenic
1128967923 15:72079163-72079185 TTTAGCATCTTGGTTAAGTGAGG - Intronic
1130758030 15:86786597-86786619 TTTAGAATAATGGTTATTTTAGG - Intronic
1135279606 16:21142628-21142650 TTTTGTATTGTTGTTATATGTGG - Intronic
1139793099 16:69456734-69456756 TTTAGTCTAGTGCTTAGCTGTGG + Intronic
1146541326 17:33698214-33698236 TATAGTGTAGCGGTTAAGTGTGG + Intronic
1147505948 17:41017673-41017695 TTTAGTAAAATTGTTTTGTGAGG - Intronic
1149078131 17:52621198-52621220 TTAAGAATATTGGTTATGTTAGG + Intergenic
1150257965 17:63764006-63764028 TTTACTTTAGTGGGTAAGTGAGG - Exonic
1150988632 17:70228845-70228867 TTTAGTGTAATGATTATCTGAGG - Intergenic
1153452169 18:5241649-5241671 TTTAAATTAGTGGTTATCTGAGG - Intergenic
1156660900 18:39345378-39345400 TTTTGTGTAGTGATTATGTCTGG - Intergenic
1157351571 18:46892141-46892163 ATCAGTATAGTGGAAATGTGGGG + Intronic
1159165262 18:64690924-64690946 TTAAGTAAAGGGCTTATGTGTGG + Intergenic
1159843160 18:73424872-73424894 TTTAGGATAAGGATTATGTGAGG + Intergenic
1164366559 19:27589465-27589487 TTTATCCTAGTGGTTATCTGTGG - Intergenic
1166618876 19:44277122-44277144 TTTAGAATGGTGGTTATCAGAGG - Intronic
1167854058 19:52224165-52224187 GTAAGAATAGTGGTTATTTGGGG + Intronic
925717756 2:6800472-6800494 CTTAAAATAGTTGTTATGTGAGG + Intergenic
926261396 2:11266666-11266688 ATTAGTATGGCGGATATGTGTGG - Intronic
928541012 2:32283436-32283458 TTTAGAATAAAGGGTATGTGTGG - Intronic
929202785 2:39255063-39255085 TTTATAATAGTGGTTATCTCAGG - Intronic
929841071 2:45463826-45463848 TTTAGTGTACTGGTTATGTGTGG - Intronic
933088964 2:78095360-78095382 TTAATTATAGTGGTTAAGTAAGG - Intergenic
939612083 2:144323704-144323726 TTTAGTATATTTATTATATGGGG - Intronic
939624057 2:144454906-144454928 TTTAGCATAGAGGGTGTGTGTGG - Intronic
939797927 2:146670471-146670493 TTTTATATTGTTGTTATGTGTGG + Intergenic
939812934 2:146856950-146856972 TTTAAAATAGTTGTTATGTTAGG + Intergenic
940113856 2:150185821-150185843 TGTGGCATAGTGGTTAAGTGTGG + Intergenic
940831114 2:158467165-158467187 TTTATTACAGTGATTATGTGAGG - Intronic
943602820 2:189941637-189941659 TTTTGCATTGTGGTTATGTGAGG - Intronic
943755228 2:191550296-191550318 GGTAGAATAGTGGTTGTGTGAGG - Intergenic
944617188 2:201473444-201473466 TTTAATATAATGTTTATTTGAGG + Intronic
1170181127 20:13531318-13531340 TTGAGTTTACTGGTTAAGTGTGG - Intronic
1170368700 20:15624844-15624866 TTTCATATAGTTGTTATGTTTGG - Intronic
1170901353 20:20466297-20466319 TTTAGTTTTTTGGTAATGTGAGG + Intronic
1171574238 20:26287029-26287051 TTCTGTATAGTTTTTATGTGAGG - Intergenic
1171720262 20:28553517-28553539 TTCTGTCTAGTGTTTATGTGAGG - Intergenic
1173417785 20:42872988-42873010 GTTATTATTGTGGTTCTGTGTGG - Intronic
1173488982 20:43463756-43463778 TTTAGTATATGGTTTATGTTGGG + Exonic
1173932021 20:46828648-46828670 TATAGTTTAGTGGTTATATGAGG - Intergenic
950306748 3:11921207-11921229 GTTAGTATGCTGGTTAGGTGTGG + Intergenic
951479616 3:23145772-23145794 TTTATATTAATGGTTATGTGGGG - Intergenic
952009186 3:28879916-28879938 TTTAGTACAAAGGTTATGTTAGG + Intergenic
952103852 3:30046934-30046956 TTTAATATAGTGGTTATTCCTGG + Intergenic
952155528 3:30639520-30639542 TGTAGCATAGTGGTATTGTGGGG - Intronic
952670484 3:35961197-35961219 TTCAATATAGTGATTATATGTGG + Intergenic
954094646 3:48316047-48316069 TTTATCTTATTGGTTATGTGAGG - Intronic
958575431 3:95944260-95944282 AGTAGAATAGTGGTTATGGGAGG - Intergenic
958834770 3:99132114-99132136 TGTAGTGTAGTGTTTAAGTGTGG - Intergenic
959656545 3:108812164-108812186 TTCAGTTTGGTGCTTATGTGTGG + Intergenic
959734750 3:109646368-109646390 TTTGATATAGTGGTTATTTTGGG - Intergenic
960134191 3:114089284-114089306 TTTAGTACAGTGGATAACTGTGG - Intergenic
960296200 3:115947497-115947519 TTTATGATAGTGGTTACGTTGGG + Intronic
962847559 3:139285399-139285421 TTTACTATAGTGGTTACCTCTGG + Intronic
963252096 3:143113126-143113148 TTTAAGATAGTAGGTATGTGAGG - Intergenic
963690068 3:148488411-148488433 TTCAGTATAGTGGTTACCTTTGG + Intergenic
963757383 3:149249813-149249835 TTTGGTATGGTGGGTGTGTGTGG - Intergenic
963947447 3:151161781-151161803 TTTAGCATAGTGGTTGAGTGTGG - Intronic
964518403 3:157538105-157538127 TTTAGGACAGTGGTTACTTGTGG + Intergenic
965532944 3:169793072-169793094 GTCAGGATAGTGGTTATGAGAGG + Intergenic
965765345 3:172124718-172124740 TTTACTTGAGTGGTTATCTGTGG + Intronic
966249569 3:177848258-177848280 TTTAGTACACTGTTTACGTGTGG - Intergenic
966545593 3:181143009-181143031 TTTAGTAATGTGGTAAGGTGTGG - Intergenic
967745787 3:193053457-193053479 ATTATTATAATGGTTATATGTGG - Intergenic
971612578 4:28744576-28744598 TTTTGTGTACTGTTTATGTGTGG + Intergenic
973184335 4:47306585-47306607 TTTAGAATAGTGGTTATCTCTGG - Intronic
978181590 4:105803896-105803918 TTCAGTATAGTGGTTATTTCAGG + Intronic
978474998 4:109116532-109116554 TTTAGTAATGTGGTAAGGTGTGG - Intronic
978749077 4:112227146-112227168 TTTGGTGTGGAGGTTATGTGTGG - Intergenic
979617815 4:122764028-122764050 TTCAGTTTAGTGGTTATCTTTGG + Intergenic
980005708 4:127540003-127540025 TTTAGCATAGTTGTGATGGGTGG - Intergenic
981771573 4:148316246-148316268 TATAATATAGTGGTCATCTGTGG + Intronic
983235040 4:165169834-165169856 TTCATTATAGTAGTTATGTCTGG - Intronic
984592663 4:181633821-181633843 TTTAGTGTCCTGGTTGTGTGGGG - Intergenic
987639746 5:20597675-20597697 ATTAGAATAGTGGTTATATTTGG + Intergenic
988235809 5:28542502-28542524 TTCAATATAGTGGCTATTTGGGG - Intergenic
991066872 5:62433406-62433428 GTTCGTATATTGGTTCTGTGTGG + Intronic
991121555 5:63020959-63020981 TTTAGTATTGTAATTATTTGGGG - Intergenic
991281977 5:64924857-64924879 TTTAGCATAGTGCTAATGAGTGG + Intronic
995303802 5:110619590-110619612 TTTAGAATAGTGCTTTTCTGTGG - Intronic
996416181 5:123212920-123212942 TTTGATATATTAGTTATGTGGGG - Intergenic
996903738 5:128574505-128574527 GTTAGTATAGGGGTGATGTGTGG + Intronic
997543759 5:134687519-134687541 TGAAGTATAGTGCTTGTGTGTGG + Intronic
998103316 5:139451961-139451983 TATAGTATAGGGTGTATGTGTGG + Intronic
998872118 5:146562640-146562662 TGTAGCATGCTGGTTATGTGTGG + Intergenic
1000257460 5:159553546-159553568 TTTATTATATTGTTTATTTGTGG + Intergenic
1003375193 6:5570268-5570290 TTTATTTTGGTGGATATGTGAGG + Intronic
1003774258 6:9341716-9341738 TTTAGTAAAGTTGTAATCTGGGG + Intergenic
1003899280 6:10638989-10639011 TTTTATATACTGGTTATGGGAGG - Intergenic
1003942045 6:11039024-11039046 TTTAGTAGAGTGGTTAGGGTAGG + Intronic
1003960204 6:11201947-11201969 TTTAGTAGAGTACTAATGTGTGG + Intronic
1008049194 6:46882702-46882724 TTTAGTGTAGTGTGTGTGTGAGG + Intronic
1008809850 6:55483177-55483199 TTTAATATAATGGATATTTGGGG + Intronic
1009391436 6:63148482-63148504 TTAAGTTTTGTGGTTATGTTTGG - Intergenic
1009784516 6:68317174-68317196 TTTATTATACTAGTCATGTGTGG + Intergenic
1011470126 6:87700939-87700961 TTTAGTATAGTGGGGGTGGGGGG - Intronic
1012328628 6:97956825-97956847 TTTAGTAGTGTGGTAAGGTGTGG + Intergenic
1015262526 6:131254841-131254863 GTTAGTATAGTCTTTTTGTGTGG + Intronic
1015770037 6:136759430-136759452 TTTAGTATAAAGGTTATTTTAGG - Intronic
1015948211 6:138524406-138524428 ATTAGGGTAATGGTTATGTGTGG - Intronic
1016084618 6:139897389-139897411 GTTTATGTAGTGGTTATGTGGGG - Intergenic
1016521082 6:144947667-144947689 TTTAGTTTACTGGTTGTTTGAGG + Intergenic
1016843781 6:148550409-148550431 TTTAGCATATTGCTTATGTCTGG + Exonic
1019957772 7:4429504-4429526 TTTTGTATAATTGTTATTTGTGG + Intergenic
1021388550 7:20063524-20063546 GTCAGTATAGTGGTTATGCTTGG + Intergenic
1023644800 7:42299542-42299564 TTTAGTAAAGTGGTGATGGTGGG + Intergenic
1024918325 7:54528455-54528477 TTTTGTATACTGGTTTTGTGTGG + Intergenic
1025015053 7:55432711-55432733 TTTACTTGTGTGGTTATGTGTGG + Exonic
1028256745 7:88608432-88608454 TTTATAATAGTGTTTTTGTGGGG - Intergenic
1028644424 7:93079231-93079253 TGTAGTTTTGTGGTTTTGTGTGG - Intergenic
1028916529 7:96265507-96265529 TGTAGTATGGTGGTTGTCTGAGG - Intronic
1029182832 7:98716692-98716714 AATAAAATAGTGGTTATGTGGGG + Intergenic
1031186438 7:118485827-118485849 TTCAGAATAGTTGTTATCTGTGG - Intergenic
1031457841 7:122006415-122006437 TGTAGAATAGTGGTTATTAGAGG - Intronic
1032106995 7:129040421-129040443 GTCAGAATAGTGGTTATGGGAGG + Intronic
1032771650 7:135065048-135065070 CTTAGTATAGTGAGGATGTGAGG - Intronic
1032925165 7:136595966-136595988 TTTAGTATTGTGGTTGTGGCAGG - Intergenic
1033516642 7:142113265-142113287 TTTAGTATGGTGGGAATATGGGG + Intronic
1037929054 8:22866576-22866598 TTTAGTATAGTGGTTATGTGTGG - Intronic
1038855685 8:31329497-31329519 TTTAGCATAGTGTCTTTGTGTGG + Intergenic
1040115539 8:43614173-43614195 CTTTTTATAGTGGTGATGTGTGG + Intergenic
1040272750 8:45973690-45973712 TTCTGTATAGTTTTTATGTGAGG - Intergenic
1040273838 8:45989112-45989134 TTTAGTCTAGTTTTTATGTGAGG - Intergenic
1041339277 8:56824697-56824719 TTTAGAATGGTGGTTATCTTTGG + Intergenic
1041594992 8:59639000-59639022 TTTACAATAATGGTTATGTGTGG - Intergenic
1041866265 8:62577551-62577573 TTTAGTATTTTAGTTATGTTTGG + Intronic
1042393175 8:68259510-68259532 TTTAGAAAAGAGGTTAAGTGAGG - Intergenic
1043543838 8:81293630-81293652 GTTAGAATAGTGGTTATTAGAGG + Intergenic
1044306013 8:90642321-90642343 TTAGGTGTAGTGGTCATGTGAGG - Intronic
1044842811 8:96351884-96351906 AGTAGTATAGTGGTTATCAGGGG - Intergenic
1045621860 8:103987727-103987749 TTTAATATTTTGGTTATGTTGGG - Intronic
1046542247 8:115600725-115600747 TCTAGTATAGTTGTTTTGTAGGG + Intronic
1047422295 8:124717176-124717198 TTAAGTAGAGTGGTTAGGGGCGG - Intronic
1050248835 9:3721852-3721874 AATAGTATTGTGGTTTTGTGGGG - Intergenic
1050841936 9:10160607-10160629 TTTAGTATAATGGTTAGCTGTGG - Intronic
1051961597 9:22771024-22771046 TTTAATATCATGGTTAAGTGTGG + Intergenic
1052033827 9:23657872-23657894 ATTAGGATAATGGTTATTTGGGG - Intergenic
1054928516 9:70612512-70612534 TTGAGTAAAGTGGATATTTGAGG - Intronic
1055118348 9:72629710-72629732 TAGAAAATAGTGGTTATGTGTGG + Intronic
1057139026 9:92715716-92715738 TTGAGTTTTGTGGTTTTGTGGGG + Intronic
1058450686 9:105093456-105093478 TTTATTTTAGTGGTTATTTTAGG + Intergenic
1059894842 9:118851224-118851246 TTAAGTATAGAGTTTATTTGAGG + Intergenic
1060843890 9:126818820-126818842 TTTTGTATAGTGTTTTTGTCTGG + Intronic
1203421473 Un_KI270521v1:2997-3019 TTCTGTCTAGTTGTTATGTGAGG - Intergenic
1203415906 Un_KI270588v1:2221-2243 TTTTGTATAGATTTTATGTGAGG + Intergenic
1187893878 X:23963060-23963082 TTTGGCATAGTGTTTATTTGGGG + Intergenic
1188100477 X:26076477-26076499 TTTAGAATAGTGGTTACCTCTGG - Intergenic
1188695659 X:33187601-33187623 TTTAGCATAGTTGCAATGTGTGG + Intronic
1188766018 X:34092054-34092076 TTTTGTTTTTTGGTTATGTGAGG - Intergenic
1189207446 X:39254101-39254123 TTTAGTATAGGGTTTTGGTGTGG + Intergenic
1190035254 X:47017167-47017189 TTCAGTATAGTGTATATATGTGG + Intronic
1190845272 X:54184955-54184977 TTTAGTATAATGGACACGTGTGG + Intergenic
1191577637 X:62724064-62724086 TTCTTTATAGTGTTTATGTGGGG + Intergenic
1192230035 X:69258146-69258168 TTCAGGAGAGTGGTTATGTCTGG + Intergenic
1193147706 X:78094086-78094108 AATAGTATTGTGATTATGTGAGG - Intronic
1193349837 X:80449810-80449832 TTTAGTCTAGTGGTAGTGTATGG - Intergenic
1193829611 X:86273693-86273715 TATAGTATTATGGTTTTGTGGGG + Intronic
1196975036 X:121149996-121150018 TTTAGTATAGTGTGTATGTATGG - Intergenic
1197020891 X:121686887-121686909 TATAGATTAGTGGTTATGGGAGG - Intergenic
1197218912 X:123893132-123893154 TTTATTATAGTTGTTATTTATGG + Intronic
1197411975 X:126127704-126127726 TTTATTATAGTCATTATGTTAGG + Intergenic
1199179689 X:144838865-144838887 TTGAGTTTAGTGGTTATATTAGG + Intergenic
1199900311 X:152166382-152166404 TGTAGTCTTGTGGATATGTGGGG - Exonic
1201064509 Y:10082119-10082141 TTTTGTGTAGTTTTTATGTGAGG + Intergenic