ID: 1037936706

View in Genome Browser
Species Human (GRCh38)
Location 8:22919858-22919880
Sequence CACACCAGCTGGTCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037936699_1037936706 19 Left 1037936699 8:22919816-22919838 CCATACCACGCCTTCTTCCACTT 0: 1
1: 0
2: 0
3: 13
4: 226
Right 1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG No data
1037936698_1037936706 20 Left 1037936698 8:22919815-22919837 CCCATACCACGCCTTCTTCCACT 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG No data
1037936700_1037936706 14 Left 1037936700 8:22919821-22919843 CCACGCCTTCTTCCACTTATCTG 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG No data
1037936697_1037936706 23 Left 1037936697 8:22919812-22919834 CCTCCCATACCACGCCTTCTTCC 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG No data
1037936703_1037936706 -9 Left 1037936703 8:22919844-22919866 CCAACTCCAAAGCACACACCAGC 0: 1
1: 0
2: 0
3: 19
4: 273
Right 1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG No data
1037936701_1037936706 9 Left 1037936701 8:22919826-22919848 CCTTCTTCCACTTATCTGCCAAC 0: 1
1: 0
2: 0
3: 16
4: 263
Right 1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG No data
1037936702_1037936706 2 Left 1037936702 8:22919833-22919855 CCACTTATCTGCCAACTCCAAAG 0: 1
1: 0
2: 0
3: 18
4: 203
Right 1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037936706 Original CRISPR CACACCAGCTGGTCTCCACC AGG Intronic
No off target data available for this crispr