ID: 1037940213

View in Genome Browser
Species Human (GRCh38)
Location 8:22945590-22945612
Sequence CTGGAGGCAGAGAGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1627
Summary {0: 1, 1: 0, 2: 12, 3: 188, 4: 1426}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037940213_1037940222 12 Left 1037940213 8:22945590-22945612 CCATCCCCACTCTCTGCCTCCAG 0: 1
1: 0
2: 12
3: 188
4: 1426
Right 1037940222 8:22945625-22945647 CGTGGATGCTTTGTGCCCCTAGG No data
1037940213_1037940219 -6 Left 1037940213 8:22945590-22945612 CCATCCCCACTCTCTGCCTCCAG 0: 1
1: 0
2: 12
3: 188
4: 1426
Right 1037940219 8:22945607-22945629 CTCCAGGTCTTTGCTCCACGTGG No data
1037940213_1037940223 13 Left 1037940213 8:22945590-22945612 CCATCCCCACTCTCTGCCTCCAG 0: 1
1: 0
2: 12
3: 188
4: 1426
Right 1037940223 8:22945626-22945648 GTGGATGCTTTGTGCCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037940213 Original CRISPR CTGGAGGCAGAGAGTGGGGA TGG (reversed) Intronic
900415826 1:2534212-2534234 CTGGAGGTGGACAGTGGTGATGG + Intergenic
900512390 1:3066832-3066854 CTGCAGGGTGAGGGTGGGGAAGG + Intergenic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900594530 1:3474700-3474722 CTTGAGGCAGAGCGTCTGGATGG - Exonic
900614382 1:3558106-3558128 CTGCAGGCAGTGAGTGCTGAGGG - Intronic
900628996 1:3624039-3624061 CTTCAGTCAGGGAGTGGGGATGG - Intergenic
900646851 1:3712939-3712961 CTGGGAGCAGAGGGTGGGGCAGG - Intronic
900655906 1:3756922-3756944 CCGGACGCAGAGAGAGGGGTGGG - Intronic
900707802 1:4091168-4091190 CTGCAGCCAGCGAGTGGGAAGGG - Intergenic
900760308 1:4466092-4466114 CTGGGGGCAGAGGGTGGGCATGG + Intergenic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
900858265 1:5203715-5203737 CAGGAGGAAGAGGGTGGGAAGGG + Intergenic
900924073 1:5692075-5692097 CTGGGGGCCGGGGGTGGGGATGG + Intergenic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
900987150 1:6079707-6079729 CTGGAGGCAGGGAGCGGGGAAGG + Intronic
901051078 1:6426202-6426224 CTGAAGGCAGAAGGTGGGGTTGG - Intronic
901067895 1:6503075-6503097 CTTGACTCAGAGAGTGGGCATGG + Intronic
901107203 1:6765803-6765825 CAGGAGGAAGAGAGAGGGAAGGG - Intergenic
901156170 1:7140937-7140959 AAGGTAGCAGAGAGTGGGGATGG - Intronic
901197280 1:7447246-7447268 CTGGAGGGAGAGAGTAGGGGAGG + Intronic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
901440309 1:9273612-9273634 CCGCAGCCAGTGAGTGGGGACGG - Intergenic
901486321 1:9565162-9565184 CTGGAGGTAGATGGTGGTGATGG + Intronic
901742326 1:11350381-11350403 CTGGAAGCAGAGAGGGGGTCCGG - Intergenic
901770532 1:11528185-11528207 CTGGAAGGAGAGCGAGGGGAGGG + Intronic
902036525 1:13462174-13462196 CTGGAATCAGACAGTGGTGATGG + Intergenic
902332189 1:15736118-15736140 CTGGAGGGAGAGCGTGGATAGGG - Intergenic
902387458 1:16083882-16083904 CTGGTGGCAAGGAGTGGGGGTGG - Intergenic
902468367 1:16631561-16631583 CTGGAGACAGAGGATGGAGAGGG - Intergenic
902505774 1:16938430-16938452 CTGGAGACAGAGGATGGAGAGGG + Exonic
902555675 1:17245248-17245270 CTGCAGGCAGTGGGAGGGGAAGG + Exonic
902776172 1:18676388-18676410 CTGGGGAGAGAGGGTGGGGAGGG + Intronic
902788816 1:18751147-18751169 CTGAAGGCAGCAAGTGGGGCTGG + Intergenic
902917358 1:19646648-19646670 CTGGGTGCAGAGGGTGTGGAGGG - Intronic
903049054 1:20587455-20587477 CTGGATGCAGTGGGAGGGGAGGG + Intergenic
903205625 1:21780455-21780477 CTGGAACCAGACAGTGGTGATGG + Intronic
903599153 1:24521970-24521992 CAGGAGACAGATAGTGGTGATGG + Intronic
903617443 1:24671244-24671266 TTGGAGGGTGTGAGTGGGGAAGG - Intronic
903686740 1:25137204-25137226 CTGCAGGAAGAGGGTGGGGTGGG - Intergenic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
903745303 1:25582665-25582687 CTGGAGATAGACAGTGGGGAAGG - Intergenic
903846129 1:26280742-26280764 CTGGGGACAGAGGGTGGGTAGGG - Intronic
903942472 1:26941372-26941394 CAGCAGGTAGAGAGTGGGGCTGG + Intronic
904013302 1:27402526-27402548 GTGGAGGCAGCAAGTAGGGAGGG + Intergenic
904266966 1:29323745-29323767 TGGCAGGCCGAGAGTGGGGATGG + Exonic
904425181 1:30418176-30418198 GTGGGGTCAGGGAGTGGGGATGG + Intergenic
904622040 1:31781543-31781565 GTGGAGGCAGAGTGGGGGGAGGG + Intergenic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
905147383 1:35897837-35897859 CTGGAATCAGATAGTGGTGATGG - Intronic
905199316 1:36305854-36305876 ATGGGGGTAGAGAGTGGGTACGG + Intergenic
905205580 1:36341131-36341153 CTGGGGGCAGGGAGTGGCCATGG + Exonic
905235417 1:36542911-36542933 CTGGAGGCTGTGAGTGGTGATGG + Intergenic
905290889 1:36921029-36921051 CTGGAGGTGGAGAGTGGGCATGG + Intronic
905340316 1:37273536-37273558 CTGGATGCTGAGAGTGGGCAAGG - Intergenic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905791643 1:40792664-40792686 CTGGTGGGAGAGACGGGGGACGG + Intronic
905865243 1:41372956-41372978 AGTGAGGCAGTGAGTGGGGAAGG - Intronic
905930733 1:41785327-41785349 GAGTAGGCAGAGAATGGGGAGGG + Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906248930 1:44296387-44296409 CTGGAGGCAGCGCGTGGGGTGGG - Intronic
906535355 1:46548282-46548304 CTGGTGGCAGAGACTGGGCTGGG + Intronic
906640177 1:47436998-47437020 CTGGGGCCAGGGAGAGGGGAGGG + Exonic
906648099 1:47490599-47490621 GTGGGGTCAGAGTGTGGGGATGG - Intergenic
906699991 1:47850740-47850762 GAGGAGGCGGAGAGTGGGCAGGG - Intronic
906734760 1:48115006-48115028 CTGCTGTCAGAGAGTGGGGGAGG - Intergenic
907629842 1:56069478-56069500 ATGGAGGGTGAGTGTGGGGAAGG + Intergenic
907652207 1:56305947-56305969 CTAGAGGCAGGTACTGGGGAGGG + Intergenic
907853683 1:58280795-58280817 ATGGGGGCAGGGAGTGGGGGTGG + Intronic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908513740 1:64871561-64871583 TTGGGGGAAGAGGGTGGGGAAGG - Intronic
908643364 1:66249668-66249690 CTGGGGGCAGGGGGTGGGGCGGG - Intronic
908826678 1:68139811-68139833 ATGGAGGTAGAAAGTGGAGATGG + Intronic
909237684 1:73174748-73174770 CTGGAGCCAGAGTGTGGGTGGGG + Intergenic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909445517 1:75744219-75744241 CTGGTGGCATCGAGTGGGTATGG + Intronic
910473521 1:87580585-87580607 ATGGTGGAAGAGGGTGGGGAGGG + Intergenic
910480647 1:87654816-87654838 CAGGAGGCAGAGAGAGGTCATGG - Intergenic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910758053 1:90711947-90711969 CAGGAGGGAGGGAGGGGGGAGGG - Exonic
911404440 1:97419155-97419177 CAGGAGGTAGAGATTTGGGAAGG - Intronic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
911632429 1:100198397-100198419 CTGGAGACAGATGGTGGTGATGG + Intronic
911647919 1:100355263-100355285 CATGAGTCTGAGAGTGGGGATGG + Intronic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
912371893 1:109179991-109180013 CTGGAGGCAGAGGCTGTGGTAGG + Intronic
912517043 1:110223001-110223023 CTCCAGGCAGAAAGTGGTGATGG - Exonic
912557077 1:110524187-110524209 CTGCAGGCAGGGCATGGGGAGGG + Intergenic
912872346 1:113320208-113320230 ATGTAGGCAGGGAGTGGGAAAGG + Intergenic
912951897 1:114126018-114126040 ATGAAGGCAGTGAGTGGGCAGGG + Intronic
913174948 1:116264965-116264987 CTGGAGGCTGAGGGTGGGAGTGG + Intergenic
913567339 1:120085648-120085670 CTAGAGGCAGAGTGTGATGAAGG - Intergenic
913630795 1:120707898-120707920 CTAGAGGCAGAGTGTGATGAAGG + Intergenic
914288087 1:146246354-146246376 CTAGAGGCAGAGTGTGATGAAGG - Intergenic
914348721 1:146821519-146821541 GTGGAGGGAGAGACTGGAGATGG + Intergenic
914549123 1:148697100-148697122 CTAGAGGCAGAGTGTGATGAAGG - Intergenic
914617559 1:149374619-149374641 CTAGAGGCAGAGTGTGATGAAGG + Intergenic
915007764 1:152655888-152655910 AGGGAGGAAGAGATTGGGGAAGG - Intergenic
915058306 1:153157907-153157929 CAGGAGACAGAGAGGGGGGTGGG + Intergenic
915129907 1:153688930-153688952 CTGGGGGCAGAGGGTGGCGGTGG - Intronic
916207354 1:162328210-162328232 GAGGAGTCGGAGAGTGGGGAGGG + Intronic
917691359 1:177472770-177472792 CTGGAGGGAGAAGGTGGGCAGGG + Intergenic
918074803 1:181161822-181161844 TTGCAGGCTGGGAGTGGGGAAGG + Intergenic
918137316 1:181686027-181686049 GGGGAGGCAGAGAGTGGGGGCGG - Intronic
918227033 1:182493439-182493461 CTGGAGGCTGAGATTTGTGAAGG + Intronic
918278912 1:182983633-182983655 CCGGAGGTAGAGAGTGATGATGG - Intergenic
918851167 1:189692659-189692681 CAGGAGGAAGAGAGAGGGCAGGG - Intergenic
919526662 1:198661887-198661909 CCGGAGGTAGGTAGTGGGGAAGG - Intronic
919809545 1:201399848-201399870 CCGAAGCCAGGGAGTGGGGAGGG - Intergenic
919816491 1:201443986-201444008 CTGAAGCCTGAGAGAGGGGAAGG + Intergenic
919851942 1:201678915-201678937 CTGGAAGCAGATGGAGGGGAGGG - Intronic
919980608 1:202640619-202640641 GGTGTGGCAGAGAGTGGGGAAGG + Intronic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920183470 1:204146811-204146833 CAGGAGGAAATGAGTGGGGAAGG - Intronic
920232123 1:204477647-204477669 CTGGAGCCAGTGGGTGGTGAGGG + Intronic
920461384 1:206143336-206143358 CTGGAGGCAGAGAGCTGGGCAGG + Intergenic
920651983 1:207844571-207844593 CTGGAGACAGATGGTGGTGAGGG + Intergenic
920837421 1:209524565-209524587 CTGGAGGCTGGGAGAGTGGAGGG + Intergenic
921126391 1:212181755-212181777 GGGGAGGCAGGGAGTGGGGAAGG + Intergenic
921165914 1:212507006-212507028 CTGAATCCTGAGAGTGGGGAAGG - Intergenic
921175675 1:212592080-212592102 CTGGAGACAGATGGTGGTGATGG - Intronic
921299046 1:213732805-213732827 CTAGGGGCTGAGATTGGGGAGGG - Intergenic
921579066 1:216874013-216874035 TGGGAGGGAGGGAGTGGGGAGGG + Intronic
921808010 1:219478094-219478116 CTGGAGAATGAGGGTGGGGAGGG + Intergenic
921888520 1:220330416-220330438 CTGGAGGGAGAGAGGGGGCTGGG - Intergenic
921996021 1:221419245-221419267 CTGGAAGTAGAGAGTGAGAAAGG - Intergenic
922175853 1:223196906-223196928 GTGGAGGCAGAGATTGGGAAAGG - Intergenic
922224735 1:223635498-223635520 CTGGAGGCAGACAGTGGGCCTGG + Intronic
922464884 1:225839806-225839828 CTGAAGGCAGAGAGAGGGGCCGG - Intronic
922473236 1:225889190-225889212 GAGGAGGTAGGGAGTGGGGAGGG + Intronic
922723093 1:227908851-227908873 GAGGAGGCAGAGAATGGAGAAGG - Intergenic
923238983 1:232062221-232062243 CTGGAAGTGGAGAGTGGGGAGGG + Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
923926946 1:238640064-238640086 CTGCTTTCAGAGAGTGGGGAAGG - Intergenic
924118863 1:240776371-240776393 GTGGAGGGAGGGAGGGGGGAAGG - Intronic
924141373 1:241027254-241027276 GTGGTGGCAGGGAGTGGGGAGGG + Intronic
924466609 1:244304246-244304268 CCGGAGGCAGAGAGTCTGGAGGG - Intergenic
1063631943 10:7742239-7742261 CGGGAGAGGGAGAGTGGGGATGG + Intronic
1063665887 10:8060368-8060390 CTGGAGGCACAAAGTGGCCACGG + Intronic
1063673482 10:8118574-8118596 GTGGAGGCAGAGATTGGGAATGG + Intergenic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1065483527 10:26216362-26216384 CTGGAGTCAGAGTGAGGGGGTGG - Exonic
1066213885 10:33267071-33267093 CAGGAGCAAGAGAGAGGGGAGGG - Intronic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1066802000 10:39202967-39202989 CTTGAGGGAGGGAGTGGGTAAGG + Intergenic
1067098156 10:43315735-43315757 CGGGAGCCAGAGGGTGGGGCTGG + Intergenic
1067160217 10:43819265-43819287 CTGGAGGCGGATAGGGTGGAGGG + Intergenic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067292851 10:44957048-44957070 CTGGACGCAGAGATGGGGGAAGG - Intergenic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1067485509 10:46646260-46646282 CTGGTGGCAAGGAGTGGGAAGGG - Intergenic
1067609249 10:47695392-47695414 CTGGTGGCAAGGAGTGGGAAGGG + Intergenic
1067716291 10:48693287-48693309 CTGGAGGCAGAGACTTGCTATGG + Intronic
1067747890 10:48950125-48950147 CTGGAGGCAGATGGTGGCGATGG - Intronic
1068046635 10:51894455-51894477 CTGGAGACAGACAGTGGTGATGG + Intronic
1068311886 10:55289456-55289478 ATGGAAGGAGAGAGTGAGGAAGG + Intronic
1068417342 10:56740981-56741003 CTAGAGGCAGAGAGATGGGGAGG + Intergenic
1068417863 10:56748170-56748192 CTGGAGGCAGTGAAAGGGAAGGG - Intergenic
1068654618 10:59561999-59562021 CAAGAGGAAGAGAGTGGGGCGGG + Intergenic
1068730762 10:60355721-60355743 CTGGAGGGAGATGTTGGGGAAGG - Intronic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069557379 10:69407048-69407070 CTGAGGGCAGAGGGTGGGGCTGG + Intronic
1069622320 10:69845580-69845602 CTGCAGGCTGAGGGAGGGGAAGG - Intronic
1069739468 10:70678471-70678493 CTGGGGTCAGGGGGTGGGGAGGG + Intronic
1069752557 10:70753692-70753714 CAGGAGCCAGAGAGTGGGTTTGG - Intronic
1069917314 10:71795679-71795701 GTGGAAACAGGGAGTGGGGAGGG - Intronic
1069995985 10:72342448-72342470 CTGCAGGCAGAGGCTGGGGCTGG + Intronic
1069995993 10:72342503-72342525 CTGGAGGAGGAGAGTGGGAGTGG - Intronic
1070279017 10:75035387-75035409 CTGGTGGCTGAGAGTGGGAGTGG - Intergenic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070369688 10:75770661-75770683 GTGGAGGCCGAGGGTGGGGTGGG + Intronic
1070425933 10:76287220-76287242 CTGTATGCTGAGAGTGGGGCAGG - Intronic
1070533541 10:77358593-77358615 CTGGAGGGAGAGAGTGGTCTGGG - Intronic
1070567646 10:77615738-77615760 ATGGAGGCAGAAAGTAGGGTTGG - Intronic
1070610272 10:77927379-77927401 CTGGAGACAAATGGTGGGGAGGG + Intergenic
1070911569 10:80123434-80123456 CTGGGGGAAGAGAGTGTGGGAGG + Intergenic
1071059052 10:81548429-81548451 CTGGAGCCAGAGAGGCTGGATGG + Intergenic
1071268049 10:83981899-83981921 CAGGAGGCAGAGGCTGCGGATGG - Intergenic
1071532556 10:86400923-86400945 CTGGAGGCAGAGAGAGCGCCTGG + Intergenic
1071569209 10:86687290-86687312 CTGGAGGCACTGAGTGGCGGTGG - Intronic
1071624838 10:87157038-87157060 CTGGTGGCAAGGAGTGGGAAGGG + Intronic
1072740685 10:97907345-97907367 CTGCAGGTAGAGAAGGGGGAGGG + Intronic
1072841569 10:98780079-98780101 AGGGAGGAAGAGAGAGGGGAAGG + Intronic
1073049272 10:100656951-100656973 CTAGAGGCGGAGGGTGGGGGGGG + Intergenic
1073165043 10:101439836-101439858 GTGGAGGCAGGAAGTTGGGAAGG + Intronic
1073520212 10:104121672-104121694 CTGGAGCCAGAGAATGGAGGCGG + Intergenic
1073572396 10:104591615-104591637 CTGGAGCCAGTGAGTGGAGTTGG + Intergenic
1073813758 10:107181977-107181999 GGGGCGGCAGGGAGTGGGGATGG + Intergenic
1073875050 10:107913728-107913750 CAGGAGGCTGAGCCTGGGGAGGG - Intergenic
1074066724 10:110021778-110021800 CTGGAGCTAGATAGTGGTGATGG + Intronic
1074467547 10:113696759-113696781 ATGAAGGCAGAGGGTGGGGGTGG + Intronic
1074472991 10:113744279-113744301 ATGGTGGAAGAGAGTGGAGAGGG - Intergenic
1074781899 10:116808221-116808243 CTGGAGGTAGACAGTGGAGAAGG + Intergenic
1074862824 10:117525171-117525193 CCAGAGGCAGAGAGTGGAGAGGG + Intergenic
1074872540 10:117588378-117588400 CTTGAGGCCGTCAGTGGGGATGG - Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075262877 10:120978097-120978119 CTGGAGGCTGAGGGTGGGGAAGG + Intergenic
1075272593 10:121065443-121065465 CTGGAGTTAGATAATGGGGATGG - Intergenic
1075408575 10:122211038-122211060 CTGGACTCAGAGAGTGCAGAAGG + Exonic
1075417846 10:122278634-122278656 CTGGAGGAAGGAACTGGGGAAGG - Intronic
1075521902 10:123148279-123148301 CAGCAGGCAGGCAGTGGGGAGGG - Exonic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075942557 10:126404070-126404092 CTGGAGGCAGAGCGAGGGCCAGG - Intergenic
1075955681 10:126520817-126520839 GTGGAGGCAGAGATTAGAGAGGG - Intronic
1075997774 10:126892533-126892555 CTTGAGGATGGGAGTGGGGATGG - Intergenic
1076045891 10:127293901-127293923 CTGGAGGCAGAGAGTTGGGTGGG - Intronic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076467770 10:130696893-130696915 CTGGGAGCTGAGACTGGGGAGGG + Intergenic
1076474038 10:130740075-130740097 CTGGAGGCCGAGAGCAGAGAGGG + Intergenic
1076649266 10:131976621-131976643 CTGGTTGCAGAGAGTGTGGTTGG - Intronic
1076745348 10:132510136-132510158 CAGGAGGCAGGGGGTGGGGTGGG - Intergenic
1076864178 10:133159338-133159360 CCGGAGGCTGGGAGTGGGGCAGG - Intergenic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077194491 11:1272402-1272424 CTGGGGGATGAGATTGGGGAGGG - Intergenic
1077370198 11:2178123-2178145 GTGGAGGCAGAGGGAGGGAAAGG + Intergenic
1077385983 11:2269702-2269724 CGGGAGGCAGGGAGGAGGGAGGG - Intronic
1077466916 11:2737881-2737903 CTGGAGGCAGGGAAAGGGGTTGG + Intronic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1077581293 11:3418864-3418886 CTGGAGGGAGAGGGAGGAGACGG + Intergenic
1077826577 11:5816236-5816258 CTGGAGATGGAGAGTGGTGATGG + Intronic
1078086205 11:8234330-8234352 CTGGAGGGAGAGAGTGGGAGGGG - Intronic
1078164573 11:8871089-8871111 CTGCAGGGAGAGAGAGGGGAGGG + Intronic
1078243442 11:9551454-9551476 GTGGAGGCTGAGAGTGGGGATGG + Intergenic
1078386371 11:10896481-10896503 CATGGGGCTGAGAGTGGGGAAGG + Intergenic
1078474357 11:11618971-11618993 CTGAAGGCAGAGGGTGGTAAAGG - Intronic
1078750076 11:14153435-14153457 CAGGAGGAAGAGAGCAGGGAGGG + Intronic
1078782536 11:14453253-14453275 CTGGAGGTAGAGAATGGAGCTGG + Intronic
1078824818 11:14919292-14919314 CAGGAGCAAGAGAGAGGGGAAGG - Intronic
1079081514 11:17416602-17416624 CTGGTGGGAGAGAGAGGGAAGGG - Intronic
1079116933 11:17645979-17646001 CTGGAAACAGAAAGTGGGGCTGG - Intronic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1079196220 11:18329601-18329623 ATGGAGGCATATAGTGGAGAAGG - Intronic
1079225254 11:18599481-18599503 CTAGAGGCAGAGATTTGGAAAGG - Intergenic
1079538233 11:21540643-21540665 CTGGAGGAAGAGAGTGAAGGGGG + Intronic
1079552945 11:21723227-21723249 CTGGAACCAGACAGTGGTGATGG + Intergenic
1079873023 11:25823236-25823258 CAAGAGCAAGAGAGTGGGGAGGG - Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080474986 11:32582102-32582124 CTGGGGGCAGGGATTGGGTAAGG - Intergenic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1081441622 11:43086960-43086982 CAGGAGGAAGAGAGTGGAGGGGG + Intergenic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1081854261 11:46294248-46294270 CTGGGGGCTGAGAGTGAGGTCGG + Intronic
1081968748 11:47184876-47184898 CTGGGGCCAGAGAGAGGGAAGGG - Intronic
1082812879 11:57489214-57489236 CGGGAGGCAGGGAGAGGGGAAGG + Intronic
1083064039 11:59905201-59905223 CTTGGGGCGAAGAGTGGGGAGGG - Intergenic
1083164519 11:60875279-60875301 TTGGGGGCTGAGAGTGGGTAAGG - Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083397503 11:62401723-62401745 CTGCAGGAAGAGAGAGGGCAGGG + Intergenic
1083548215 11:63564673-63564695 CTGGAGGGAGACAGTAGGGTTGG + Intergenic
1083593744 11:63909472-63909494 CTGGAGGCAAAGGAAGGGGAGGG + Exonic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083734391 11:64671252-64671274 GTAGAGGGAGATAGTGGGGACGG + Intronic
1083749186 11:64752072-64752094 CTGGAGGCAGAGACGGGGAAGGG + Intronic
1083768628 11:64854272-64854294 CGGGAGGCAGAGACGGGGGGAGG - Exonic
1083854201 11:65384358-65384380 CGGGAGGCTGATGGTGGGGAAGG - Intergenic
1083920383 11:65779092-65779114 CTGGAAGCAGAGAGTGGCCAAGG + Exonic
1084188933 11:67490222-67490244 CTGGAGGCTGAGGGGGAGGATGG + Intronic
1084401832 11:68948680-68948702 CTGGAGACAGATGGTGGTGATGG - Intergenic
1084461823 11:69300437-69300459 CTGGAGACAGAGAGGGGTGGAGG + Intronic
1084588066 11:70074734-70074756 CTGGAGGCAGAGGGTGCTGCTGG + Intergenic
1084686236 11:70697525-70697547 TTGGAAGCAGATAGTGGTGATGG + Intronic
1085022893 11:73220096-73220118 CTGGTGCCAGAGACAGGGGATGG - Intronic
1085147094 11:74210626-74210648 GTGGAAGCAGAAAGAGGGGAGGG - Intronic
1085453776 11:76654669-76654691 GTGGTGGCTGAGAATGGGGAGGG - Intergenic
1085460538 11:76690442-76690464 AGGGAGGCTGAGCGTGGGGAAGG - Intergenic
1085491433 11:76922253-76922275 CTGGAGGCAGGGAGTGCAGGAGG - Intronic
1085728402 11:78975264-78975286 CTGGAGGCAGCGCGTGGGCAAGG - Intronic
1086229024 11:84546283-84546305 CAGGAGGAAGAGAGAGGGCAGGG - Intronic
1086501601 11:87459349-87459371 TTAGAGTCAGAGAGTGGGGAAGG - Intergenic
1086537930 11:87871274-87871296 CTGGTGGCAGACGGTAGGGAGGG - Intergenic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1086906463 11:92423673-92423695 CTGTAGAGAGAGGGTGGGGAGGG + Intronic
1087102725 11:94380774-94380796 CTGGGGGCAGGAAGTGGGGAGGG + Intronic
1087585917 11:100121497-100121519 GTGGGGGCAGGGGGTGGGGAGGG + Intronic
1088544726 11:110947806-110947828 CTCTAAGAAGAGAGTGGGGAAGG + Intergenic
1088683315 11:112263975-112263997 CTGGAAGTAGATAGTGGTGATGG + Intronic
1089138790 11:116270162-116270184 GGGCAGGCAAAGAGTGGGGATGG - Intergenic
1089209054 11:116788512-116788534 CTTGAGGCTGGGATTGGGGAAGG - Intergenic
1089252234 11:117173082-117173104 TTGGAGGCAGAGATTTGAGACGG + Intronic
1089291671 11:117441135-117441157 TTGGGGGAAGAGAGCGGGGAGGG + Intronic
1089329096 11:117677474-117677496 CAGGGGGCAGGGAGAGGGGAGGG + Intronic
1089333868 11:117709300-117709322 ATGGGGTCAGAGACTGGGGAGGG + Intronic
1089577824 11:119459371-119459393 CAGTAGGCAGAGAGAGGGGTTGG + Intergenic
1089592944 11:119556389-119556411 TTGGTGGCAGAGAGGGGAGAAGG + Intergenic
1089665313 11:120014292-120014314 CTGGAGGCAGCCTGTGGGGCAGG - Intergenic
1089737139 11:120557263-120557285 CTGCAGGCAGAGGGAAGGGATGG - Intronic
1089767706 11:120780246-120780268 CTGGAGATAGATAGTGGTGATGG - Intronic
1089824215 11:121258984-121259006 CTGGAGGCAGGGAGGTGGGGGGG - Intergenic
1090227342 11:125079661-125079683 CTGCAGGGAGAGAGAAGGGAGGG - Intronic
1090613429 11:128492720-128492742 TTGGAGGTGTAGAGTGGGGATGG - Intronic
1090668660 11:128930975-128930997 ATGGAGGCAGGGATTAGGGAGGG + Intergenic
1090948140 11:131449473-131449495 CTGGTGGCAGAGTGTGGGCTAGG + Intronic
1091381767 12:66660-66682 CTGGAGGTAGGGGGTGGGGTGGG + Intergenic
1091449306 12:562592-562614 CTGGAGGCAGGGAGAGGAGTGGG + Exonic
1091912289 12:4242310-4242332 GTGGAGGTAGAGGGTGGGGGTGG + Intergenic
1091936924 12:4441962-4441984 CTGCACACAGAGAGTGGGGCTGG - Intronic
1091970864 12:4785820-4785842 ATGGAGGCTGGGACTGGGGATGG + Intronic
1092051286 12:5472518-5472540 CTGGAGGGAGAAAGTGAGGGTGG - Intronic
1092140781 12:6182082-6182104 CTGGAGGAAGGGACAGGGGATGG + Intergenic
1092155876 12:6281171-6281193 CGGGAGGGAGAGAGAGGGAAGGG - Intergenic
1092207519 12:6624355-6624377 CTGGAAACAGAGAGTGGTGACGG - Intronic
1092408893 12:8239333-8239355 CTGGAGGGAGAGGGAGGAGACGG + Intergenic
1092650862 12:10633594-10633616 CTGGAGGCAAAGATTAGGAATGG + Intronic
1092699515 12:11212337-11212359 CTGGAGGGAGGGAGAGAGGAGGG + Intergenic
1092831920 12:12452568-12452590 CGGGAGGGAGTGGGTGGGGAAGG - Intronic
1092979593 12:13780586-13780608 CTGGAGGTAGATAGTGGGAAGGG + Intronic
1093083935 12:14845630-14845652 GGGGAGCGAGAGAGTGGGGAGGG + Intronic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093122887 12:15294546-15294568 CTGCTGCCAGGGAGTGGGGAGGG - Intronic
1093522345 12:20065977-20065999 CTGGAGAAAGAGAGTAGGCAGGG + Intergenic
1093808445 12:23464550-23464572 CTGGAGGCAGGGAGGCTGGATGG + Intergenic
1093821282 12:23621360-23621382 CTGGACACAGACAGTGGTGATGG + Intronic
1094003180 12:25718482-25718504 CAGGAGGCAGATAAGGGGGAAGG + Intergenic
1094080440 12:26528828-26528850 CTGGAGGCACAGGGTGGGTGAGG + Intronic
1094304545 12:29003241-29003263 CTTGAGGCAGAGTGTGGGAATGG + Intergenic
1094480059 12:30874543-30874565 CTGGGGGCAGTGAGTGGGGTGGG - Intergenic
1094520702 12:31185101-31185123 AGGGAGGGAGGGAGTGGGGAGGG + Intergenic
1095332774 12:40988963-40988985 ATGGAGGCAAATACTGGGGATGG - Intronic
1095692062 12:45100901-45100923 CTGGAGGTAGAGAGAGGTAAAGG - Intergenic
1095957794 12:47816763-47816785 CTGGAGGAGGGCAGTGGGGATGG + Intronic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096225676 12:49865479-49865501 CTGGAGGCAGGGGGTGGCAAGGG + Intergenic
1096233458 12:49910314-49910336 GAGGAGGCAGAGAGTGGTGCAGG - Intergenic
1096267465 12:50135149-50135171 AGGGAGGGAGAGAGAGGGGAGGG + Intronic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1096460178 12:51818112-51818134 CCAGGGGCAGGGAGTGGGGAGGG - Intergenic
1096542249 12:52314410-52314432 CTGAAGGCTGAGACAGGGGAAGG + Exonic
1096582330 12:52593944-52593966 CTGGAGGTGGACAGTGGTGATGG + Intronic
1096628011 12:52907093-52907115 CAGGAGGCAGGGCCTGGGGAGGG - Intronic
1097035254 12:56119604-56119626 CTGGGGGTGGAGAGAGGGGAGGG + Intronic
1097178335 12:57156467-57156489 CTGGAGGCTGAGTGGGTGGATGG - Intronic
1097238180 12:57553965-57553987 CTGGAGGTAGAGAGGGTGGGTGG + Intronic
1097407778 12:59212006-59212028 CTGGATGTTGATAGTGGGGAAGG - Intergenic
1097650518 12:62292404-62292426 CTCTAGGCAGAGAGTGGGACAGG + Intronic
1097787428 12:63776908-63776930 GTGGGGGAGGAGAGTGGGGATGG + Intergenic
1098431299 12:70422881-70422903 CTGGGAGCACAGAGTGGCGACGG + Intronic
1098978570 12:76930648-76930670 CAGGAGGCAGACAGGGGAGAGGG + Intergenic
1100069253 12:90691236-90691258 ATGAAGGCAGAGAGAGGTGAGGG + Intergenic
1100341946 12:93687622-93687644 TTGGAAGCAGTGAGTGAGGAAGG - Intronic
1100432747 12:94545234-94545256 CTGGAGGTAGACGGTGGGGATGG + Intergenic
1100569086 12:95829360-95829382 CTGGAGGCAGATGGTGGTGATGG + Intergenic
1100581269 12:95942761-95942783 CTGGAGGCAGAGCCCCGGGAGGG - Exonic
1100664282 12:96733992-96734014 AGGGAGGAAGAGTGTGGGGAGGG + Intronic
1100813535 12:98363526-98363548 CAGGAGGAAGAGAGAGGGTAGGG + Intergenic
1100822191 12:98441998-98442020 CAAGAGGTAGAGAGTGGGGCTGG + Intergenic
1101926207 12:108973313-108973335 CCGAGGGCAGGGAGTGGGGATGG + Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1102208706 12:111108665-111108687 GTGGAGACAGAGAGGGGAGATGG - Intronic
1102389335 12:112536908-112536930 CTGGAGGCAGAGGCTGGGTGAGG + Intergenic
1102437437 12:112936331-112936353 CTGGAGGCAGAGATGAGGAAAGG + Intergenic
1102764814 12:115423268-115423290 AGGGAGGGAGGGAGTGGGGAGGG + Intergenic
1102913674 12:116737559-116737581 AGGGAGGCAGGGAGAGGGGAAGG + Intronic
1103038089 12:117672696-117672718 CTGGAGGCAGAGGTTGTGGTGGG - Intronic
1103173628 12:118843552-118843574 CAGGAGGGAGATAGTGGGGTAGG + Intergenic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103487867 12:121295547-121295569 CTGGGGGCAGAGCTAGGGGAGGG + Intronic
1103556783 12:121771210-121771232 CTGGAGGGAGCGAGTGAGGCTGG + Intronic
1103615489 12:122149116-122149138 CTGAAGGAAAAGAGTGGAGATGG - Intergenic
1103938361 12:124488624-124488646 CTGGAGGGAGGGAGTGGAGGAGG + Intronic
1104002101 12:124866301-124866323 ATGGAGGCAGAGAGATGGGCAGG - Intronic
1104412867 12:128573765-128573787 CTTGAGGCAGATGGTGGTGATGG + Intronic
1104676853 12:130716986-130717008 CTGGAGGCTTGGGGTGGGGAGGG - Intergenic
1105024192 12:132837841-132837863 GTGGAGGCAGAGGGCGGGCACGG + Intronic
1105040265 12:132956000-132956022 TGGGAGGCAGAGGGTGGGGTGGG - Intronic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1105218888 13:18307432-18307454 CTGGAGGCAGAGCCTGGGGGAGG - Intergenic
1105548021 13:21365920-21365942 GAGGAGGCAGACAGAGGGGAAGG - Intergenic
1105553787 13:21426391-21426413 TTTGAGGAAGACAGTGGGGAGGG - Intronic
1106037417 13:26056617-26056639 CTGGAACCAGACAGTGGTGATGG + Intergenic
1106435342 13:29718708-29718730 CTGGAAACAGATAGTGGTGATGG - Intergenic
1106442505 13:29789252-29789274 CTGGAGACAGATTGTGGTGATGG + Intronic
1106597086 13:31153849-31153871 AGGAAGGGAGAGAGTGGGGAGGG + Intronic
1107428363 13:40316600-40316622 ACAGAGGCAGAGAGTTGGGAGGG - Intergenic
1107553290 13:41496419-41496441 CTGAAGGCAGAGGGTGGGCCTGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1108460545 13:50662882-50662904 TTGGTGGCAGTGAGTGGAGAAGG - Intronic
1108573218 13:51769923-51769945 CTGGAGCCAGAGCGTGTGGCTGG - Intronic
1108744086 13:53372165-53372187 TTTGAGGCAGAGAGGTGGGAGGG - Intergenic
1109630001 13:65033380-65033402 CTGGCGGCAGTGAGTGGTGCTGG + Intergenic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1110994996 13:82096697-82096719 CTGGAGGCTGAGACAGGAGAAGG + Intergenic
1111146282 13:84185098-84185120 ATGGAGGCTGAGAGAGGTGAGGG - Intergenic
1111175906 13:84596079-84596101 CAGGAGGAAGAGAGAGGGAAGGG - Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1111294411 13:86260318-86260340 CTGGACTTAGAGAGTGGTGACGG - Intergenic
1111985102 13:95057970-95057992 CTGGCTGCAGAGGGTGGAGAAGG - Intronic
1112007220 13:95264472-95264494 CCGGAGGCACACAGTGGTGATGG - Intronic
1112286154 13:98106166-98106188 CAGGAGGCAGATAAAGGGGAGGG - Intergenic
1112487792 13:99835439-99835461 ATGGAGGAAGAGAGAGTGGAGGG + Intronic
1112498503 13:99924339-99924361 CTGGAAACAGATAGTGAGGATGG + Intergenic
1112546216 13:100373660-100373682 CTGGAGGTAGATGGTGGTGATGG + Intronic
1112819931 13:103321192-103321214 CTGGAAATAGAGAGTGGTGATGG - Intergenic
1113174342 13:107545303-107545325 CTGGAAGCTGAGAGTGGGGCAGG + Intronic
1113272789 13:108693312-108693334 CTGGGGCCAGATAGTGGTGATGG - Intronic
1113672952 13:112187494-112187516 AGGGAGACAGAGAGAGGGGAGGG + Intergenic
1113756741 13:112817577-112817599 CTGGCTGCAGAGAGTGTGAAGGG - Intronic
1113801278 13:113087684-113087706 CTGCGAGCAGAGAGTGGAGATGG - Intronic
1113857533 13:113456203-113456225 CTGGAAGCAGAGCCTGGGGAAGG + Intronic
1114168492 14:20246753-20246775 CTGGAAACAGATAGTGGTGATGG + Intergenic
1114378701 14:22177360-22177382 CTGGGAGAAGACAGTGGGGAGGG + Intergenic
1114752825 14:25224744-25224766 CAAGTGGCAGGGAGTGGGGAAGG - Intergenic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115859171 14:37665485-37665507 CTGGAGCCAGTCAGTGGGTATGG + Intronic
1115933664 14:38527271-38527293 AAGGAGGGAGAGAGTGGGGGAGG + Intergenic
1116557668 14:46333391-46333413 TTTGAGGTAGTGAGTGGGGAGGG + Intergenic
1117033805 14:51705584-51705606 CTTGAGAAAGAAAGTGGGGAGGG + Intronic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117289274 14:54316764-54316786 CAGGAGGCAGATAAGGGGGAGGG + Intergenic
1117340613 14:54788467-54788489 CAGGAGGAGGAGGGTGGGGATGG - Intronic
1117486445 14:56202619-56202641 CTGGAGTCTGGGAGTGGGGAAGG + Intronic
1117492891 14:56269865-56269887 CTGCAGCCAGAGAGTTGGGCAGG - Intronic
1117559847 14:56925845-56925867 GTGGAGGTGGAGAGTGGGGTAGG + Intergenic
1117835425 14:59800084-59800106 CTGGAAGCTGAGAGTGAGGCAGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118231383 14:63953676-63953698 CTGGTGACAGAGAGTGGTGATGG - Intronic
1118586042 14:67354049-67354071 CTGGAGGCTGAGAAGGGTGAGGG - Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1118688454 14:68314837-68314859 GTGGTGGCAGTGGGTGGGGAGGG - Intronic
1118789478 14:69076686-69076708 CTGAAGGTAGATAGTGGTGATGG + Intronic
1118835350 14:69473954-69473976 CTAGGGGCAGAGGGTGGGAATGG + Intergenic
1118884289 14:69853574-69853596 CTGGAGGCAGGGTGTGGGGTGGG + Intergenic
1119168518 14:72515260-72515282 CTGGAGGAAGAGGAAGGGGAGGG - Intronic
1119169505 14:72523513-72523535 CTGGAAGCAGGGACTGGGGGTGG + Intronic
1119180216 14:72600332-72600354 CTGGGGACAGAGAGGAGGGAGGG - Intergenic
1119205928 14:72793543-72793565 ATGGAGGTAGAGTGTGAGGATGG - Intronic
1119208476 14:72812229-72812251 CTGGGGGCCGGGGGTGGGGATGG - Intronic
1119377463 14:74206376-74206398 AGGGAGGCAGGGAGGGGGGAGGG - Intergenic
1119380352 14:74224404-74224426 CTGAGGGGAGAGGGTGGGGAGGG + Intergenic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1119727138 14:76928365-76928387 GTGGAGGAGGGGAGTGGGGAAGG - Intergenic
1119732067 14:76957240-76957262 CTGGTGGCAGAGGGTGGGATGGG - Intergenic
1119741199 14:77014629-77014651 GTGGGGGCAGAGTGAGGGGAGGG + Intergenic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1119798766 14:77423988-77424010 CCAGAGGCTGAGGGTGGGGAGGG - Intergenic
1120016561 14:79480807-79480829 CAAGAGGAAGAGAGAGGGGAAGG - Intronic
1120576350 14:86186069-86186091 CAGGAGGCAGGGAGGGGGGAGGG - Intergenic
1120681741 14:87488290-87488312 CTGGAGGCCGAGAGGAGTGAGGG - Intergenic
1120794909 14:88622033-88622055 CTGGAGGCGGACAAGGGGGAGGG - Exonic
1120846007 14:89125773-89125795 CAGAAGGCAGACAGTTGGGAGGG - Intronic
1121193425 14:92048924-92048946 CTGGGAGCAGAGACTAGGGAGGG + Exonic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1121432497 14:93897927-93897949 CTGGAGGCTGGGGCTGGGGAGGG + Intergenic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1121979155 14:98439151-98439173 CTGAAGGCAGAGAGTGGTTTGGG + Intergenic
1122142661 14:99672150-99672172 CTGGGGGCATGGAGTGGGCAGGG + Intronic
1122251855 14:100445535-100445557 CTGCAGGCTGGGAGTGGAGAAGG + Intronic
1122343371 14:101043230-101043252 CTGGAGGCAGTGGGAGAGGAGGG + Intergenic
1122362200 14:101174185-101174207 ATGGAGGCCCAGGGTGGGGATGG - Intergenic
1122414417 14:101542030-101542052 CTGGAGGCTGAGCGGGTGGAGGG - Intergenic
1122689440 14:103524833-103524855 CAGGAGGGTGAGAGAGGGGAGGG - Intergenic
1122740374 14:103868533-103868555 CTGGGGGCCCAGAGTGGGCAGGG - Intergenic
1122792680 14:104190937-104190959 CTGGGGGCAGAGGGTGGGGCTGG + Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122916400 14:104860970-104860992 CTGGAGATAGAGGGTGGTGATGG - Intergenic
1122916415 14:104861061-104861083 GTGGAGATAGAGAGTGGTGATGG - Intergenic
1122916464 14:104861321-104861343 GTGGAGACAGAGGGTGGTGATGG - Intergenic
1122916515 14:104861581-104861603 CTGGAGATAGAGGGTGGTGATGG - Intergenic
1122916522 14:104861607-104861629 GTGGAGACAGAGGGTGGTGATGG - Intergenic
1122939277 14:104973976-104973998 CAGGAGGCAGGGGATGGGGAGGG - Intronic
1122983943 14:105203645-105203667 CAGGAGGCAGAGGGAGGGGTGGG + Intergenic
1202829209 14_GL000009v2_random:8086-8108 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1202900921 14_GL000194v1_random:37938-37960 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1123398805 15:19963801-19963823 CAGGATGCAGATAGTGGAGAAGG + Intergenic
1123714724 15:23019334-23019356 CCTGAGGCAGAGAGTGTGCACGG + Exonic
1124023760 15:25946099-25946121 ACTGAGGCTGAGAGTGGGGAAGG + Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124371011 15:29104653-29104675 CTGGAGGCAGAGGGTGTGCCTGG - Intronic
1124444825 15:29721373-29721395 CAGGAGGAAGAGAGTTGGGGAGG - Intronic
1124496305 15:30189438-30189460 GGTGTGGCAGAGAGTGGGGAAGG + Intergenic
1124586562 15:31014987-31015009 CTTGAGGCAGGGGGTGGGGGTGG + Intronic
1124747269 15:32349209-32349231 GGTGTGGCAGAGAGTGGGGAAGG - Intergenic
1124982913 15:34581786-34581808 CAAGAGCCAGACAGTGGGGACGG + Intronic
1125725391 15:41865906-41865928 GTGAAGGCCGAGGGTGGGGAGGG + Intronic
1125828099 15:42692800-42692822 CTGGAGGCACAGGGTGGGTAAGG - Exonic
1125934185 15:43620351-43620373 TTTGAGGGAGAGAATGGGGAAGG - Intergenic
1125947289 15:43719817-43719839 TTTGAGGGAGAGAATGGGGAAGG - Intergenic
1126096571 15:45094764-45094786 CAAGAGACAGAGAATGGGGAGGG + Intronic
1126147414 15:45488981-45489003 TTGAAGGCAGGGAGTGGGAATGG + Exonic
1126173698 15:45715973-45715995 CCAGAGGCAGAGAGTAGGGATGG - Intergenic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127254610 15:57278724-57278746 AGGGAGGGAGAGAGAGGGGAGGG - Intronic
1127875630 15:63109048-63109070 CAGCAAGGAGAGAGTGGGGATGG - Intergenic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128178966 15:65583592-65583614 CTGGAACTAGAGAGTGGTGATGG + Intronic
1128221276 15:65970374-65970396 CTGCAGGCCGAGGGTGAGGAGGG + Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128760639 15:70214084-70214106 CTGGAGAAAGGGAGTCGGGAGGG - Intergenic
1128763708 15:70237574-70237596 CTGGTGGCAGTGGTTGGGGATGG + Intergenic
1128920197 15:71603450-71603472 CAGGAGGCAGATAAAGGGGAGGG - Intronic
1129227368 15:74177917-74177939 CTGGAGGGAGGGAATGGGGCTGG - Intergenic
1129249639 15:74301862-74301884 GTGGAGAGAGAGAGGGGGGAGGG - Intronic
1129325923 15:74800285-74800307 CTGGAGTCACTGAGTGGGGAGGG - Intronic
1129369705 15:75083425-75083447 CTGGAATCAGATAGTGGGGATGG + Intronic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129515072 15:76152317-76152339 CTGAGGGCAGAGTGTGGGCAGGG + Intronic
1129682660 15:77666558-77666580 CTGGAGGCAGAGGAGGGTGATGG + Intronic
1129825278 15:78630868-78630890 TTGGAGGCTGAGGGAGGGGAGGG - Intronic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1130281327 15:82522342-82522364 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1130330611 15:82919280-82919302 CTGAAGGCAGAGAGAGGTGTTGG - Intronic
1130361790 15:83194461-83194483 CTGGAGATAGAGAGTGGTGATGG + Intronic
1130472702 15:84238525-84238547 TTGGAGGAAGATTGTGGGGAGGG - Intronic
1130480193 15:84353096-84353118 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1130484422 15:84390667-84390689 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1130491576 15:84435033-84435055 TTGGAGGAAGATTGTGGGGAGGG + Intergenic
1130503191 15:84514073-84514095 TTGGAGGAAGATTGTGGGGAGGG + Intergenic
1130555849 15:84922143-84922165 CTGCAGGGAGGGAGTGTGGATGG - Intronic
1130563728 15:84978180-84978202 CGGAAGGAAGGGAGTGGGGAAGG + Intergenic
1130594996 15:85243159-85243181 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1130700292 15:86172504-86172526 CCAGAGGCTGGGAGTGGGGAAGG - Intronic
1130876027 15:88015401-88015423 CAGGAGGCAGACAGGGGGCAGGG - Intronic
1130995778 15:88903216-88903238 GGGGAGGCTGAGAGTGAGGAGGG - Intronic
1131159515 15:90095744-90095766 CCGGAGGCAGTGAATGTGGAAGG + Intronic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131254379 15:90852451-90852473 GTGGAGGCAGTGAGTAGGGAAGG + Intergenic
1131407291 15:92175813-92175835 ATGGATGGAGAGAGTGGGGGTGG - Intergenic
1131937652 15:97524214-97524236 CTGGAAGCAGAGGGTGAGGCTGG - Intergenic
1132081847 15:98872761-98872783 TAGGAGGCAGAGCATGGGGATGG - Intronic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132382597 15:101376948-101376970 CTGGAGGGAGAGGCTGGGTAAGG + Intronic
1132850830 16:2024186-2024208 CTGGAGGCAGAGAAAGGCGAAGG - Intergenic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1132986122 16:2768605-2768627 CTGGAGGCAGGGAGAGGGATGGG - Intronic
1133003018 16:2860614-2860636 CGGGAGGCAGAGAGGGAGGCTGG - Intergenic
1133147890 16:3803692-3803714 GTCCAGGAAGAGAGTGGGGAGGG - Intronic
1133164329 16:3936034-3936056 AGGGAGGCAGAGAGAGGGTAGGG - Intergenic
1133197322 16:4180419-4180441 CTGGAGGCAGGTTGTGTGGAGGG - Intergenic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1133349860 16:5094150-5094172 CTGGAGGGAGAGGGAGGAGACGG + Intronic
1133388029 16:5386522-5386544 CTGAATGCAAAGAGTAGGGAGGG - Intergenic
1133393219 16:5425966-5425988 CTGGAAGGAGAGAGTGTGCAGGG + Intergenic
1133417229 16:5616233-5616255 CGGGAGGCAGAGGGTGGTGCTGG - Intergenic
1133453872 16:5925550-5925572 CTGGAAGCAGGTAGTGGTGATGG + Intergenic
1133535976 16:6702850-6702872 CTGGAGACAGATGGTGGTGATGG - Intronic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1134210653 16:12273690-12273712 CTGGAATTAGAGAGTGGCGATGG - Intronic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1134879021 16:17728119-17728141 CTGGAGGTGGAGAGAGGGGCTGG - Intergenic
1135124334 16:19795420-19795442 CTGGACTTAGAGAGTGGTGACGG + Intronic
1135164610 16:20128065-20128087 CAGGGGCCAGAGAGAGGGGAAGG - Intergenic
1135249889 16:20891906-20891928 CTGGGGACAGAGGGTAGGGAAGG - Intronic
1135544343 16:23355652-23355674 CTGGAGGCAGAGCCTGAGGCAGG + Intronic
1135888162 16:26332497-26332519 CTAGAGGTAGAGAGTAGGGGTGG + Intergenic
1135928566 16:26717179-26717201 GAGGGGACAGAGAGTGGGGAAGG - Intergenic
1136073792 16:27804799-27804821 GTGGAGGCTGAGATTGGGGGCGG + Intronic
1136580927 16:31150252-31150274 CTGGAGGCCCAGGGTGGGGGTGG + Intergenic
1137388874 16:48064997-48065019 TTGGAGGCAGAGGCTGTGGAAGG + Intergenic
1137706376 16:50538653-50538675 CTGGAGGCAGAGAGGGGATTTGG + Intergenic
1137720620 16:50625462-50625484 CTGGATGCAGAGAGATGGGCGGG - Intronic
1137723451 16:50641346-50641368 CTGGAGGCTTAGAGTGGGCAGGG - Intergenic
1137743023 16:50799322-50799344 GGAGAGGGAGAGAGTGGGGAAGG + Exonic
1137810038 16:51343973-51343995 GTGGAGGAATAGTGTGGGGAGGG - Intergenic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138133444 16:54501431-54501453 CTGGAGGTGGATAGTGGTGACGG - Intergenic
1138535111 16:57655839-57655861 TTGGAGGAAGAGAGTAGGGAGGG - Intronic
1138634720 16:58328531-58328553 CTGGAGCTAGATAGTGGGGATGG + Intronic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1139246224 16:65446975-65446997 GTGTAGGCAGAGAGAGGGAAAGG + Intergenic
1139259270 16:65576563-65576585 CAGGAGTGAGAGAGTGAGGAAGG + Intergenic
1139338899 16:66254218-66254240 CTGGAGGCAGAGACAGGGGGAGG + Intergenic
1139596538 16:67961597-67961619 GAGGAGGCCGAGAGTGGGGAGGG - Exonic
1139695753 16:68673436-68673458 CTAGAGAGAGAGAGAGGGGAGGG - Intronic
1139780649 16:69348687-69348709 CTGGAGGCAGAGACTGCAGTGGG - Intronic
1139959032 16:70707158-70707180 TTGGAAGCAGAGAGTTGGAAGGG - Intronic
1139985315 16:70894029-70894051 GTGGAGGGAGAGACTGGAGATGG - Intronic
1140137623 16:72221603-72221625 CTGGAGGGAGAGTATGGGGAAGG + Intergenic
1140461613 16:75144624-75144646 CTGGAAGGAGAAAGTGGTGATGG - Intergenic
1140465350 16:75176768-75176790 CAGGAGGGAGGAAGTGGGGAGGG + Intergenic
1140735681 16:77895914-77895936 CTGGAGGAAGAGAGCTGGGCAGG + Intronic
1140957279 16:79877245-79877267 CTGGAAGCAGAGGGTGCAGAAGG + Intergenic
1141149879 16:81556660-81556682 CTGGAGGCCGACAGTGGCGATGG + Intronic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141458802 16:84163908-84163930 CAGGAGGCTGAGAGGTGGGAGGG - Intronic
1141484678 16:84330790-84330812 CTGGAGCCTGAGTGTGGGGTGGG - Intergenic
1141495027 16:84403666-84403688 CTGGAGATAGAGAATGGCGATGG - Intronic
1141659761 16:85435547-85435569 CTGGGGGCTGAGGGAGGGGAGGG + Intergenic
1141761399 16:86030991-86031013 CTGGAGCCAGAGAGATGGCATGG - Intergenic
1141928119 16:87182520-87182542 CTGGGAGCAGAGTGTGGGGCAGG - Intronic
1142002060 16:87669805-87669827 CTGCAGGCAGCCAGTGTGGATGG + Intronic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142159036 16:88547489-88547511 GAGGAGACAGAGGGTGGGGAAGG + Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142223511 16:88866467-88866489 CTGGGGCCAGAGGGTGGGGAAGG - Exonic
1142357016 16:89606052-89606074 CTGGAGGCAGGGGAAGGGGAAGG - Intergenic
1142360727 16:89625317-89625339 AGGGAGGCAGAGAGTGAGGGGGG + Intronic
1142530046 17:573367-573389 GAGGAGGCAGGAAGTGGGGATGG - Intronic
1142578367 17:924645-924667 CTGGAGACAGATGGTGGTGATGG - Intronic
1142698198 17:1644988-1645010 CTGGAGCCAGTGAGAGGGCAGGG - Intronic
1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG + Intronic
1143057845 17:4175792-4175814 CTGGGAGGAGAGAGTGGGGAAGG + Intronic
1143103363 17:4515816-4515838 CAGGAGACAGGGAGTGGGGGTGG + Intronic
1143161787 17:4876714-4876736 GCGGAGGCAGAAAGTGAGGATGG - Intronic
1143362717 17:6384669-6384691 CTGGAGCCATGGAGTGGGGAGGG - Intergenic
1143370441 17:6435840-6435862 CTGAAGGCAGATTCTGGGGAGGG - Intergenic
1143374133 17:6457555-6457577 CTGGAGGCGGGGAGTTGTGAGGG - Intronic
1143474040 17:7192879-7192901 CTGGAGGGAGGCAGTGGGGTGGG + Intronic
1143527770 17:7482412-7482434 CTCAAGGCAGAGGGTGAGGACGG - Exonic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1143869222 17:9946115-9946137 CTGGAATCAGATAGTGGGGATGG - Intronic
1143988159 17:10933357-10933379 CAGGAGAGAGAGAGTGGGGGCGG + Intergenic
1144180394 17:12746155-12746177 CTGGAGTAAGAGAGTGGGAGGGG + Intronic
1144267637 17:13586450-13586472 CTGGAGGCAGAGTCAGAGGAGGG - Intronic
1144305965 17:13969830-13969852 CTGGAGGCAAGGAGTGGAGTTGG - Intergenic
1144662151 17:17078088-17078110 CTGGGGACAGGGAGTGGGCAAGG - Intronic
1144864296 17:18324950-18324972 CTGGAGGCAGAGGCTGTGCAGGG + Intergenic
1145001288 17:19306683-19306705 TTGGAGGGGGAGAGTGGGCACGG - Intronic
1145096360 17:20031583-20031605 CTGGAGACAGATGGTGGTGAGGG - Intronic
1145269030 17:21394670-21394692 CTCGAGGCTGAGGGTGGGGAAGG + Intronic
1145313812 17:21716582-21716604 ATGGAGGCAGAGGGTGGAGGTGG + Intergenic
1145712254 17:26988556-26988578 ATGGAGGCAGAGGGTGGAGGTGG + Intergenic
1145823223 17:27856731-27856753 CAGGAATCAGAGAGTGGGGTAGG - Intronic
1146008479 17:29177080-29177102 GTGGAGGCTTAGAGAGGGGAGGG - Intronic
1146093060 17:29901687-29901709 AGGGAGGAAGGGAGTGGGGAAGG - Intronic
1146212837 17:30955631-30955653 CGGGAGGCAGAGGGTGCAGAGGG + Intronic
1146230929 17:31108377-31108399 CGGGAGGCTGAGAGAGAGGATGG - Intronic
1146307789 17:31743919-31743941 CTGGAGCCAGGCAGTGGGGATGG - Intergenic
1146417448 17:32649279-32649301 CTGGAGAAAGATAGTGGTGATGG - Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1146762581 17:35491319-35491341 CTGGAGGAAGAAAGTAGGAAGGG - Intronic
1146945451 17:36870160-36870182 CAGGACCCAGAGAGTGGGAAGGG + Intergenic
1147047831 17:37767848-37767870 AAGGAGGCAGAGCGTGGGGCTGG - Intergenic
1147139232 17:38452237-38452259 CTGGGGGCAGAGGGAGGGGAAGG - Intronic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147154897 17:38539522-38539544 CAGGAGGGAGAGAGCAGGGAAGG - Intronic
1147163795 17:38582611-38582633 GGGGTGGCAGAGAGAGGGGAGGG + Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147335275 17:39723752-39723774 CTGGAGGCAGTGTTTGGGGGAGG + Intronic
1147337470 17:39736280-39736302 GCGGAGACAGAGAGTGGGGTTGG - Intergenic
1147719180 17:42527875-42527897 CTGGAGGCTGAGACAGGAGATGG + Intergenic
1147743654 17:42682546-42682568 CAGGAGACAGAGGCTGGGGAAGG + Intronic
1147917932 17:43899887-43899909 CTGGGGGCAGAGATGGGCGAAGG + Intronic
1148102280 17:45099538-45099560 CAGGGGGCAGAGAGAGGGCAAGG + Intronic
1148170547 17:45515933-45515955 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148171024 17:45519926-45519948 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148278658 17:46329879-46329901 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148300868 17:46547741-46547763 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148364996 17:47048626-47048648 GTGGGAGCAGAGAATGGGGAGGG + Intergenic
1148614658 17:48991197-48991219 GGGGAGGAAGAGAGAGGGGAGGG + Intergenic
1148723869 17:49774795-49774817 CTGCAGGCTGATAGTGGGAAAGG + Intronic
1148797759 17:50205300-50205322 ATGGAGGGAGGGAGTGTGGAGGG + Intergenic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1149676719 17:58471128-58471150 CTGGAGATAGACAGTGGTGATGG + Intronic
1150138200 17:62707256-62707278 GTGCAGGCAGGGAGTGGGGCGGG - Intronic
1150449876 17:65257843-65257865 TTGGGGGGTGAGAGTGGGGATGG + Intergenic
1150477931 17:65488436-65488458 AGGGAGGCAGAGAGAGGGGGAGG + Intergenic
1150630620 17:66877782-66877804 CTGGGAGCAGAGTGTGGGGAAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150676277 17:67247321-67247343 CTGGAGGCAGTGAATGGGTTGGG - Intergenic
1150842630 17:68623048-68623070 CTGGAGGCAGAGAGTATGGGTGG - Intergenic
1150930680 17:69581481-69581503 CTGGAGGGAAGGCGTGGGGAGGG - Intergenic
1151200957 17:72467787-72467809 TTGGAGGCTGACAGTGGGGAGGG - Intergenic
1151217943 17:72590884-72590906 GTGGGGGCAGAGGGTGGGGAAGG + Intergenic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1151668132 17:75557323-75557345 CAGGCGGCAGAGAGTGGAGAGGG + Intronic
1151701057 17:75742768-75742790 CTGGGTGGGGAGAGTGGGGAAGG + Intronic
1151844160 17:76639768-76639790 CTGGAGGTAGGGAGTGGGGGTGG + Intronic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1151871537 17:76840268-76840290 GGGGAGGCAGAGAGCTGGGAGGG - Intergenic
1151878780 17:76882128-76882150 CTGTGGGCAGAGTGTGGGTATGG - Intronic
1151887140 17:76929783-76929805 CTGGGGGCAGAGCGAGGGTAAGG - Intronic
1152032439 17:77852815-77852837 GTGGAGGCAGAGAGGCGGCAGGG + Intergenic
1152095301 17:78268829-78268851 CTGGCGGCAGGGGGTGGGCAGGG - Intergenic
1152189008 17:78876857-78876879 CTCCAGGCAGAGAGGGGAGATGG - Intronic
1152227449 17:79098959-79098981 CTGGAGGCAGTGAGGACGGAGGG + Intronic
1152238380 17:79149964-79149986 ATGGGGGCTGAGGGTGGGGATGG + Intronic
1152326389 17:79641864-79641886 CAAGAGGAAGAGAGAGGGGAAGG - Intergenic
1152349203 17:79774464-79774486 CTGGAGGCAGGGGGTGGTTAAGG - Intergenic
1152585210 17:81186227-81186249 CGGGAGGCTGGGAGTGGGGTGGG - Intergenic
1152760145 17:82103462-82103484 GTGGGGGGAGGGAGTGGGGATGG - Intronic
1153094903 18:1389793-1389815 CTGGAGGTAGGGAGTTGGGGAGG - Intergenic
1153322877 18:3790779-3790801 GTGGCGGCAGGCAGTGGGGAAGG + Intronic
1153525715 18:5992709-5992731 CAAGAGGGAGAGAGTGGGGGTGG - Intronic
1153551013 18:6261958-6261980 CTGGCGGCAGAGTGGGGGGGTGG + Intronic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1154115511 18:11610023-11610045 CTCAAGGCAGAGGGTGAGGATGG - Intergenic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1154313801 18:13287598-13287620 CTGAGGGCAGACAGTGGAGAAGG - Intronic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155233027 18:23793042-23793064 TTGGAGGCAGAGGGAAGGGAAGG + Intronic
1155307860 18:24496687-24496709 CTGGAGGTAGATGGTGGTGATGG - Intergenic
1155571434 18:27198013-27198035 CTGGAGGCAGAGAATGAGTGAGG + Intergenic
1156217364 18:35013321-35013343 CTGGAGGCAGCCAGTGGACAAGG + Intronic
1156233155 18:35174505-35174527 GTGCAGGAAGACAGTGGGGATGG - Intergenic
1156327766 18:36089727-36089749 CTGGAAGTAGATAGTGGTGATGG + Intergenic
1156457461 18:37302781-37302803 CAGGAGGCAGAGGGTGGTGCGGG + Intronic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1156667962 18:39431387-39431409 CTTGAGGGAAAGAGTGGGGGGGG + Intergenic
1156766879 18:40667217-40667239 GTGGAGTCAGAGAGAGGGGCTGG + Intergenic
1156769840 18:40706875-40706897 CTGAAGGCATAGACTTGGGATGG - Intergenic
1157332264 18:46712542-46712564 CTGCAGGCACAGAGGAGGGAGGG - Intronic
1157473820 18:48008887-48008909 CTGGAGGTCGAGAGTGGGGGAGG - Intergenic
1157568199 18:48694331-48694353 CTGGAGACAGAGAGCAGGGAGGG + Intronic
1157622513 18:49024591-49024613 CAGGAGGTAGAGGCTGGGGAGGG - Intergenic
1157818968 18:50751578-50751600 GGGGAGGCAGGGAGAGGGGAAGG + Intergenic
1157847011 18:51013417-51013439 TTGGAGGCAGAGATTTGGGGAGG + Intronic
1157874469 18:51259741-51259763 CAGGAGGATGAGGGTGGGGAGGG - Intergenic
1157880853 18:51319839-51319861 CTGGAGACAGAGAGAGTGAAGGG + Intergenic
1158057703 18:53301577-53301599 ATGGAGGCAGGGTTTGGGGAGGG - Intronic
1159148584 18:64488737-64488759 CTGGAGACAGATGGTGGTGATGG + Intergenic
1159598538 18:70406574-70406596 CTGGAGGAAGAGAGTGGAGGGGG + Intergenic
1159673966 18:71258276-71258298 GTGAAGGGAGAGAGTGAGGATGG - Intergenic
1159923034 18:74243390-74243412 CTGGAGGTGGAGAGGAGGGATGG + Intergenic
1160016364 18:75143889-75143911 TGGGAAGCAGAGTGTGGGGAGGG - Intergenic
1160063413 18:75552045-75552067 CTGGAGGCAAAGGGAGGGGGTGG + Intergenic
1160186777 18:76682045-76682067 CTGGAGCTGGAGAGTGGTGATGG - Intergenic
1160196299 18:76758424-76758446 CTGGAGACAGAGGGTGGTGTTGG - Intergenic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160239781 18:77114869-77114891 CTGCAGGGAGGAAGTGGGGAAGG + Intronic
1160605410 18:80046090-80046112 TTGGAGGCAGAGAGAGGAGGTGG + Exonic
1160773346 19:843656-843678 CTGGAGGAAGAGGGCGGGGCGGG - Intronic
1160816156 19:1036698-1036720 GCGGAGACAGAGAGCGGGGAGGG - Intronic
1160839708 19:1140623-1140645 GAGCAGGCAGAGAGCGGGGAAGG + Intronic
1161023244 19:2021675-2021697 CTGCAGCCAGAGAGAGGGGCTGG - Intronic
1161031495 19:2059823-2059845 GTGGGGGCAGGGAGTGGGCAGGG + Intergenic
1161139583 19:2639687-2639709 AGGGAGGCAGGGAGTGGGGGAGG + Intronic
1161163980 19:2775749-2775771 CTGGAACCAGAGAGTGGTGATGG + Intronic
1161217024 19:3099688-3099710 CCAGAGGCAGGGAGTGGGGATGG - Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161297460 19:3527086-3527108 CGGGAGACAGGGAGTAGGGAGGG - Intronic
1161454017 19:4361343-4361365 CTGGCGCCATGGAGTGGGGAAGG + Exonic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1161846348 19:6713743-6713765 GTGGGGGCTGGGAGTGGGGAAGG - Intronic
1161988383 19:7670054-7670076 CTGGAGGCAGGGAGTGAGGGTGG - Intronic
1162015667 19:7845323-7845345 GTGGAGGCAGCGGCTGGGGATGG - Intronic
1162141243 19:8586647-8586669 CTAGAGGCAGACGGTGGGGCTGG + Exonic
1162151440 19:8648403-8648425 CTGGAGGCGGATGGTGGTGATGG + Intergenic
1162365235 19:10244583-10244605 CAGGAGGCTGAGTGTGAGGATGG + Intergenic
1162549536 19:11350955-11350977 CTGCAGGCAGCGAGTGGTGCGGG - Exonic
1162827370 19:13261651-13261673 CTGGAGGCAGAAGGTTGGGCAGG - Intronic
1162855594 19:13465992-13466014 CTGGAGGAAGGTGGTGGGGAGGG + Intronic
1162904555 19:13816033-13816055 ATGGGGGGAGAGAGAGGGGAAGG + Intronic
1162947746 19:14054062-14054084 CTGGAGGCAGAGAAAAGGGGAGG - Exonic
1162947755 19:14054095-14054117 CTGGAGGCAGAGAGAAAGGGAGG - Exonic
1162958101 19:14111034-14111056 CTGGAGACAGGTAGTGGGGGTGG - Intronic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1162976493 19:14209500-14209522 CAGGAGGCAAAGAGTGCGGAGGG + Intergenic
1163000438 19:14363526-14363548 TTGGAGGCTGGGGGTGGGGAGGG + Intergenic
1163053743 19:14703627-14703649 CTGGAGGCAGAAAGGAGCGAGGG + Intronic
1163121880 19:15223288-15223310 CTGGAGGCAGGGAGAGGGACAGG + Intergenic
1163167445 19:15508026-15508048 CAGGATCCAGAGAGAGGGGAAGG + Intergenic
1163458997 19:17425076-17425098 CAGGATGCAGTGAGTGGGGGTGG - Exonic
1163535591 19:17874471-17874493 CTGTAGACAGAGTGTGGGGCGGG - Intronic
1163704231 19:18803106-18803128 CCGGAGGTAGAGACAGGGGATGG - Intergenic
1163746607 19:19052470-19052492 CCAGGGGCTGAGAGTGGGGAAGG + Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164004201 19:21133978-21134000 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1164852915 19:31499870-31499892 CAGAAGGCAGATAGTAGGGACGG + Intergenic
1165070300 19:33251584-33251606 CTGGACGAAGAGCCTGGGGAAGG - Intergenic
1165120559 19:33556131-33556153 CTGGAGGCCAAGGGTGGGGGTGG - Intergenic
1165252649 19:34553126-34553148 CTTGAGGAAGGGAGTGGGTAAGG + Intergenic
1165905070 19:39188808-39188830 CTGGAGTCTGAGAGAGGGGTCGG - Intergenic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166076211 19:40415068-40415090 CCGGTGGCTGAGAGTGGGCAGGG - Intergenic
1166109510 19:40613671-40613693 CTCGAGGCAGTGAGGGGGGGCGG + Intronic
1166411028 19:42555522-42555544 CTGGAGGAAGGGAGCGGGGGAGG - Intronic
1166502556 19:43353051-43353073 CTGGAGAAAGAGGGTGGGGGTGG + Intergenic
1166686661 19:44800528-44800550 CTGTAGGCGGAGAGAGGGGTGGG - Intronic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166792925 19:45408530-45408552 CAGGAGGCAGTGAATGGGCACGG + Exonic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1167052966 19:47090883-47090905 CTGGAGGCAGGGAAGGGGGCAGG + Intronic
1167498443 19:49832230-49832252 CATGAGGCAGGGAGTGGGGGTGG - Intronic
1167602929 19:50465056-50465078 CAGGAGGGAGAGACTGGAGACGG - Intronic
1167787975 19:51651419-51651441 ATGGGGGCGGAGAGTGGGGTTGG - Intergenic
1168187400 19:54708908-54708930 CTGCAGGCAGAGCCTGGGGCTGG - Intergenic
1168285993 19:55333748-55333770 CTGGAAGTAGATAGTGGTGATGG - Intronic
1168351718 19:55679904-55679926 CTGGAGGCAACGAGGAGGGATGG + Intronic
1168426490 19:56243278-56243300 CTGGAGCTAGACAGTGGTGATGG + Intronic
1168499331 19:56880169-56880191 CTGGAGGCAGATGGTGATGATGG + Intergenic
1168638463 19:58014302-58014324 CTTGAGGAAGGGAGTGGGTAAGG + Intergenic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
1202643486 1_KI270706v1_random:119703-119725 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
924998776 2:387034-387056 GTGGATGCAGAGAGCGGTGAGGG - Intergenic
925008201 2:461895-461917 CTGGAGGCAGAGCCTGGCCAGGG - Intergenic
925017594 2:543654-543676 TAGGAGGCAGGGAGGGGGGAGGG + Intergenic
925017642 2:543784-543806 TGGGAGGCAGGGAGGGGGGAGGG + Intergenic
925031523 2:653670-653692 CTGGAAGCAGAGACTGGGGCCGG - Intergenic
925180781 2:1815685-1815707 CTGGGGGCAGGGCATGGGGAAGG - Intronic
925185266 2:1842618-1842640 CAGGAGCCAGAGGGTGGGGCGGG - Intronic
925305723 2:2846893-2846915 CTGGAGGCAGAGCCAGGCGAGGG + Intergenic
925416504 2:3673470-3673492 CTGGAGTCAGAGCCTGGGGCAGG + Intronic
925588579 2:5487574-5487596 CTGGAGGGAGAGACTTGGGACGG + Intergenic
925658239 2:6173490-6173512 GTAGAAGGAGAGAGTGGGGATGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925895420 2:8468022-8468044 CCGGAGGTGGAGAGTGGGGATGG - Intergenic
925920576 2:8634991-8635013 GTGGAGGCAGAGGCTGGAGAGGG - Intergenic
925982636 2:9189622-9189644 CTGGACGCAGGCAGAGGGGAAGG + Intergenic
926052668 2:9754714-9754736 CTGGAGAGAGAGGGTGGGCAGGG + Intergenic
926248204 2:11136668-11136690 CTGGAATCAGAAAGTGGTGATGG + Intronic
926386937 2:12344812-12344834 CTGGAGACAGACAGTGGTGATGG - Intergenic
927436580 2:23071758-23071780 CTGGAGTCTGTGAGTGGGGTGGG - Intergenic
927740118 2:25561299-25561321 GTGAAGGCAGAGAGTGGATAGGG - Intronic
927758896 2:25732559-25732581 CTGGAGACGGACAGTGGTGATGG - Intergenic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927865736 2:26586111-26586133 CCGGGGGCAGAGAGAGAGGAGGG - Intronic
928170629 2:29000820-29000842 ATGGAGGCAGAAGGTGGGGTTGG + Intronic
928239091 2:29571074-29571096 CTGGAGGGAGATAGTGGAGGGGG + Intronic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
928428927 2:31201999-31202021 CTGGAGGGAGAGAGTGGCCCCGG + Intronic
928432012 2:31227992-31228014 CACCAGGCAGAGGGTGGGGAAGG + Intronic
928644874 2:33341314-33341336 CTTGAGGCAGAGACTGGTCAGGG + Intronic
929127177 2:38532738-38532760 TGGGAGGGAGATAGTGGGGAAGG - Intergenic
929171198 2:38934665-38934687 AGGGAGGGAGAGAGGGGGGAGGG - Intronic
929495305 2:42436287-42436309 CTGGAGTTAGATAGTGGTGATGG + Intergenic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
929922073 2:46179841-46179863 GTGGAGGCAGGGAGTTGGGGGGG - Intronic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
930752197 2:54945047-54945069 GGGGAGGCAGAGAGGGAGGAGGG - Intronic
931319237 2:61159902-61159924 CTGGAGGCAGACAGTGGTGATGG - Intronic
931421331 2:62130474-62130496 ATGGAGGGTGAGAGTGGGAAAGG - Intronic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932449202 2:71798880-71798902 CTGGAGACAGACAGCGGGAAGGG + Intergenic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
932540727 2:72649213-72649235 TGGGTGGCAGGGAGTGGGGATGG + Intronic
932947812 2:76257877-76257899 CTGGTAGGAGAAAGTGGGGAAGG + Intergenic
933000261 2:76912803-76912825 CAGGAGGATGAGAGTGGGGGAGG - Intronic
933693769 2:85199863-85199885 CTGGAATTAGAGAGTGGTGATGG - Intronic
933898609 2:86833557-86833579 AGGGAGGGAGAGAGAGGGGAGGG - Intronic
934058149 2:88269802-88269824 CTGGAGGCAGTGCCTGTGGAGGG + Intergenic
934505869 2:94893162-94893184 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
934563856 2:95327722-95327744 CTTGAGGCTGAGAGAGGGAATGG + Intronic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
934851170 2:97702199-97702221 CTGGAGTCAGAGGGTGGGTAGGG - Intergenic
934858892 2:97747642-97747664 CTGGAATGAGAGAGTGGTGATGG + Intergenic
934932364 2:98436895-98436917 CAGGAGGCAGATAAGGGGGAAGG + Intergenic
935137212 2:100318060-100318082 CTGGAAGAAGAGAGAGGGGAAGG - Intronic
935210842 2:100938499-100938521 ACGGAGGGAAAGAGTGGGGAGGG - Intronic
935665736 2:105510432-105510454 CGGGAGGCAGAGATTGCGGTGGG + Intergenic
935815064 2:106839638-106839660 ATGGAGGGAGAGACTGGGGGTGG - Intronic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936574575 2:113642378-113642400 CTGGGGGGAGGGGGTGGGGAAGG - Exonic
936651605 2:114433567-114433589 CTATGGGCATAGAGTGGGGAGGG + Intergenic
937065703 2:119015529-119015551 CGGGAGGCGGGGTGTGGGGAGGG - Intergenic
937081632 2:119144553-119144575 ATGGAGGGAGACAGTGGGCAGGG + Intergenic
937145423 2:119640257-119640279 CTGGATACAGAGACTGCGGAAGG - Intronic
937487059 2:122326272-122326294 CTGGAGGAAAAGAAAGGGGAAGG + Intergenic
937873348 2:126802273-126802295 GTGGGGGCAGAGAGGTGGGAGGG + Intergenic
937985587 2:127636771-127636793 CTGGGGGCAGAGAGGGTGGGTGG - Intronic
938139813 2:128786324-128786346 CTGGAAACAGAGTGTGGTGATGG - Intergenic
938320035 2:130356374-130356396 CGGGGGGCAGAGAGTGAAGACGG - Intronic
938341453 2:130539213-130539235 CTGGAGGCAGGGAGAGGGCAGGG + Exonic
938348376 2:130581496-130581518 CTGGAGGCAGGGAGAGGGCAGGG - Intronic
938981397 2:136530657-136530679 CTAGAAGCAGAGAGTAAGGAGGG - Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
940077695 2:149761620-149761642 CTGGTGGCAGAGAGCGGGAGAGG - Intergenic
940167670 2:150793017-150793039 CTGGAGCCAGGGAGTCTGGATGG + Intergenic
940566936 2:155376907-155376929 CTGGAAGCAAAAAGTGGAGATGG + Intergenic
940683303 2:156813854-156813876 CGGCAGGCAGAGAATGGGTACGG - Intergenic
940981350 2:160007334-160007356 CTGGGGGCAGAGGCTGGGGGTGG - Intronic
941092216 2:161190865-161190887 CTGGAGGTAGATGGTGGTGATGG + Intronic
941452184 2:165672854-165672876 CTGGAAGAAAAGACTGGGGAAGG + Intronic
942076979 2:172365137-172365159 CTGCAAGCTGAGAGTGGGGGTGG + Intergenic
942305156 2:174599943-174599965 GTGGGGGCAGGGGGTGGGGATGG + Intronic
942320918 2:174735154-174735176 CTGGAATCAGAGTGAGGGGAAGG - Intergenic
942526635 2:176860182-176860204 CAAGAGGTTGAGAGTGGGGAAGG + Intergenic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
943053173 2:182941538-182941560 CTGGGGCCAGAGACTGGGGTAGG + Intronic
943679103 2:190749080-190749102 CTGGAGGATGAGAGTGAGGCTGG + Intergenic
943752785 2:191527142-191527164 CTGGAATTAGAGAGTGGTGATGG - Intergenic
944087590 2:195867516-195867538 CTGGAGGGAGATAGTTGTGATGG - Intronic
945013203 2:205486633-205486655 CAGGAGGAAGAGAGTGGGTTGGG + Intronic
946247166 2:218394464-218394486 CAGGAGGCAGGAGGTGGGGAGGG + Intronic
946290134 2:218738292-218738314 TAGGAGGAAGAGAGTGGAGATGG - Exonic
946397786 2:219451883-219451905 CTCAAGGCTGAGAGTGGGAAGGG - Intronic
946541028 2:220684792-220684814 AAGGAGGCAGAGAGATGGGATGG + Intergenic
946766618 2:223046555-223046577 TCGGAGGAAGAAAGTGGGGAGGG - Intergenic
946809571 2:223509350-223509372 CTGGAAATAGAGAGTGGTGATGG - Intergenic
946892832 2:224296148-224296170 CTGTAGGTAGAGGATGGGGATGG - Intergenic
947179431 2:227399033-227399055 AAGGAGGCAGGGAGGGGGGAGGG + Intergenic
947612572 2:231532994-231533016 CTGTAGGCAGTAAGTGGGGTGGG - Intergenic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
948266507 2:236638906-236638928 CTGGAGTGAGAGGGTGGGAAAGG - Intergenic
948375860 2:237519812-237519834 CTGGGGGCTGAGTGTGGGGTTGG + Intronic
948444967 2:238025576-238025598 CTGGAGGCAGAAGGTAGGGTAGG - Intronic
948699156 2:239749616-239749638 TTGGAGGCAGGGACTGGGAAAGG + Intergenic
948783705 2:240340223-240340245 TTTGAGGCATGGAGTGGGGAGGG - Intergenic
948853312 2:240718771-240718793 CTGGTGACAGCTAGTGGGGATGG - Intronic
1168753532 20:299926-299948 CTGGTGGCAATGAATGGGGAAGG - Exonic
1168784904 20:530081-530103 CTGGAATCAGATAGTGGTGATGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169340214 20:4790605-4790627 CTGGAGTCTGAGAGAGGAGAGGG + Exonic
1170291608 20:14776205-14776227 CTGGAGCCAAAGAGTGGGTTTGG + Intronic
1170312841 20:15011671-15011693 CTGGATGGAGAGAGAGGGGAAGG - Intronic
1170329034 20:15188245-15188267 CTGGGGGCAGAGGGAGGTGAAGG - Intronic
1170430106 20:16267875-16267897 CTGGGGGCTGGGAGTTGGGAGGG - Intergenic
1170656944 20:18296374-18296396 CTGGAGATAGATAGTGGTGATGG - Intronic
1170784767 20:19457974-19457996 CTGGAGGAAAAAGGTGGGGAAGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1170994095 20:21335214-21335236 CTGGAGGCAGAGTGATTGGAGGG + Intronic
1171022965 20:21603338-21603360 ATGGAGTCAGAGAGTGGAGTGGG - Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171893456 20:30738642-30738664 TGGGATGCAGAGAGTGGGGTTGG - Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172114001 20:32563103-32563125 GTGGAGGCAGGGAGAGTGGAGGG + Intronic
1172150568 20:32787410-32787432 GTGGAGGCAGACAGTGGAGATGG + Exonic
1172248976 20:33465689-33465711 CTGGAGCCAGATGGTGGGGATGG - Intergenic
1172422894 20:34832390-34832412 CTGGAGGTAGATGGTGGTGATGG + Intergenic
1172585517 20:36080926-36080948 CTGGAATTAGAGAGTGGTGATGG + Intergenic
1172796166 20:37539987-37540009 CTTGAAGCAGAGATTGGGGGAGG + Intergenic
1172813651 20:37669694-37669716 CTGGCAGCAGAGATTGGGAAGGG + Intergenic
1172870491 20:38132567-38132589 CAAGAGGCACAGAGAGGGGAAGG + Intronic
1172888927 20:38249882-38249904 GAGGAGGGAGGGAGTGGGGAGGG - Intronic
1173055007 20:39603600-39603622 CTGGAGACAGATGGTGGTGACGG - Intergenic
1173234212 20:41228994-41229016 CTGGAGGCAGATGGTGATGATGG - Intronic
1173399706 20:42713821-42713843 CTGGAGGAAGAGAGAGGGGGAGG - Intronic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173760461 20:45555267-45555289 CTGGAGGTGGAGAGTAGGGTGGG - Intronic
1173788249 20:45810964-45810986 TTGGAGGCAGGGAGAGGAGAAGG - Intronic
1173850242 20:46213228-46213250 CTGCTGGCAGAGGCTGGGGAAGG - Intronic
1174568664 20:51485354-51485376 CTGGAAGCTGAGAGTGGAGAGGG - Intronic
1174600798 20:51723243-51723265 CTTGGGGAAAAGAGTGGGGAGGG + Intronic
1174796799 20:53529062-53529084 ATGGAGGCAGAGATTGGAGTGGG - Intergenic
1174933099 20:54836993-54837015 CTTGAAGGAGAAAGTGGGGAGGG + Intergenic
1174992740 20:55530091-55530113 CTGGGGGCAGGGAGTGGGCAAGG + Intergenic
1175514812 20:59562269-59562291 CTGGAGGTGGATGGTGGGGATGG + Intergenic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175534441 20:59698291-59698313 CTGGATGGAGAGAGAGGGGCAGG + Intronic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1175732090 20:61361081-61361103 CTGGCGTCATAGAGTTGGGAAGG + Intronic
1176034591 20:63030005-63030027 GTGGAGGCAGAGCCTGGGGCTGG + Intergenic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176155938 20:63620448-63620470 CTGGAGTCAGAGTGTGGGGGAGG + Intronic
1176283437 20:64328173-64328195 CTGGAGGTAGGGGGTGGGGTGGG - Intergenic
1176303926 21:5113737-5113759 CTGGCGGCAGAGGGAGGGGCAGG + Intergenic
1176515906 21:7783259-7783281 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1176608393 21:8852926-8852948 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1176620295 21:9052716-9052738 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1176745492 21:10648544-10648566 CAGGATGCAGATAGTGGAGAAGG + Intergenic
1177063137 21:16397565-16397587 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1177807655 21:25889733-25889755 CAGGAGGCTGAGAGTGAGGTAGG + Intronic
1177821361 21:26034241-26034263 TTGCAGGGAGAGAGAGGGGAAGG - Intronic
1178095581 21:29211858-29211880 CTGGAAGCCTACAGTGGGGAAGG + Intronic
1178649934 21:34413271-34413293 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1178660742 21:34505521-34505543 CTGGAGGGAGAGTGTGAGGCAGG + Intergenic
1179217199 21:39377882-39377904 CCAGAGGCAGAGACTGGGGGCGG + Intergenic
1179447533 21:41443016-41443038 CTGAAGACAGACAGTGGTGATGG + Intronic
1179486820 21:41715855-41715877 CTGGGGGTAGGGAGTGGGGCAGG + Intergenic
1179626111 21:42650444-42650466 CTGCAGGCAGAGCCAGGGGAAGG + Intergenic
1179676100 21:42983220-42983242 CTGGAGACAGATGGTGGTGATGG - Intronic
1179853104 21:44148213-44148235 CTGGCGGCAGAGGGAGGGGCAGG - Intergenic
1179886122 21:44314901-44314923 CTGGGGGCAGAGGGTGGGTTTGG + Intronic
1180051528 21:45333700-45333722 ATGTAGCCAGAGGGTGGGGAGGG - Intergenic
1180153154 21:45962780-45962802 CAGGAGGCAGATAATGGGGAGGG - Intergenic
1180358476 22:11862730-11862752 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1180379786 22:12129600-12129622 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
1180590415 22:16932500-16932522 CTGAAGGCAGAAAGTGAGGCAGG + Intergenic
1180666733 22:17519187-17519209 CTGGTGGTGGGGAGTGGGGAGGG + Intronic
1180723471 22:17927013-17927035 CTGGAGATAGACAGTGGCGATGG - Intronic
1180938274 22:19640215-19640237 CTGGAGCCAGATGGTGGAGACGG - Intergenic
1180960754 22:19761308-19761330 CTGGCGGCAGCACGTGGGGAGGG - Intronic
1181360044 22:22327401-22327423 CTGGATGCAGATCGAGGGGAGGG + Intergenic
1181387960 22:22558513-22558535 AAAGAGGCAGAGAGTGGGGGAGG + Intronic
1181806235 22:25375992-25376014 CTGCAGGCAGAAGGTGGTGAAGG - Intronic
1181851099 22:25750569-25750591 CTGGAGGCAGGCAGAGGGGTTGG - Intronic
1181960736 22:26619860-26619882 GTGGGGGCAGAGAAGGGGGATGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182280832 22:29216981-29217003 CTGGTGGGAGGGAGAGGGGAAGG + Intronic
1182314104 22:29432168-29432190 CTTGAGGGAGGGAGTGGGTAAGG - Intergenic
1182322375 22:29486386-29486408 CTGGAGACAGACAGTGGTTATGG - Intronic
1182977730 22:34639039-34639061 GAGGATGCAGAGAGAGGGGATGG - Intergenic
1183170297 22:36182917-36182939 CTAGAAACAGAGAGTGGGGCAGG - Intergenic
1183245419 22:36689703-36689725 CTGGCTGCAGAGAGATGGGAGGG - Intronic
1183269380 22:36851114-36851136 ATGGAGGCCGAGAGTGAAGAAGG - Intergenic
1183325333 22:37188302-37188324 ATGGAGGGAGAGAGGGCGGAGGG + Intronic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183458643 22:37936381-37936403 CAGGAGGGACAGAGTGGGGCAGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183912769 22:41091874-41091896 CGGGAGCCAGAGAGTGCGGAGGG + Exonic
1183935234 22:41258114-41258136 GAGGAGGCAGAGAGTGGAGGGGG + Intronic
1183947191 22:41333105-41333127 ACTGAGGCACAGAGTGGGGAGGG + Intronic
1184088977 22:42282677-42282699 CTGGGGGCAGAGACCTGGGAGGG + Intronic
1184099904 22:42336534-42336556 TTGGAGGCAGAGACGGGTGAAGG - Intronic
1184115094 22:42417614-42417636 GTTGGGGCAGAGAGTGAGGAGGG + Intronic
1184208885 22:43023584-43023606 CTGGAGGCAGGGGGTGGGTGAGG + Intergenic
1184274264 22:43401228-43401250 CGGGCGGCTGAGAGTGGGGGAGG + Intergenic
1184274595 22:43403124-43403146 GTGGAGGAATAGAGTGGGGTTGG + Intergenic
1184298899 22:43543476-43543498 CTAGAGGCAGAGAGTTGAGTGGG - Intronic
1184344909 22:43907357-43907379 CTGTAGGAAGAAAGAGGGGAGGG - Intergenic
1184429299 22:44431905-44431927 CAGGAGGTAAAGAGTGGGGAGGG + Intergenic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
1184498813 22:44859826-44859848 CTGCATGCGGTGAGTGGGGAAGG + Exonic
1184637713 22:45848246-45848268 CAGGAGGAAGAGAGTGAGGGTGG + Intergenic
1184639689 22:45863819-45863841 GAGGGGGCACAGAGTGGGGAAGG - Intergenic
1184691324 22:46118623-46118645 CTGGAGGCTGAGCGGGAGGAAGG - Intergenic
1184755157 22:46511713-46511735 CTGAAGGCCAACAGTGGGGAAGG + Intronic
1184807627 22:46805695-46805717 CTGGAAACAGAGAGGTGGGATGG + Intronic
1184824041 22:46934919-46934941 GTGAAGGGAGAGGGTGGGGAGGG + Intronic
1184867377 22:47209269-47209291 CTGGAGGAAGAATGTGGGGCTGG + Intergenic
1184927409 22:47652909-47652931 CTGAAGGAAGGAAGTGGGGATGG + Intergenic
1184971055 22:48020109-48020131 CAGGAGGCAGTGATTAGGGAGGG + Intergenic
1184986158 22:48136766-48136788 CTTGAAGCAGGGGGTGGGGAGGG + Intergenic
1185011707 22:48318284-48318306 CTGGAGGCGGAGGGTGGTGATGG - Intergenic
1185065224 22:48628686-48628708 CTGGAGCCAGAGACAGGGCATGG + Intronic
1185219142 22:49620424-49620446 ATAGAGGCAGAGGGTGGGGAAGG - Intronic
1185384891 22:50527077-50527099 GTGGAGGGAGGCAGTGGGGACGG + Intronic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
1185413984 22:50699859-50699881 CTGGTGGCTTAGAGTGTGGAAGG + Intergenic
949113563 3:292776-292798 CAAGAGGGAGAGAGTGGGGGAGG + Intronic
949693500 3:6667608-6667630 CTGGAGCCAGAGAGGCCGGATGG - Intergenic
949698711 3:6730337-6730359 CAGGAGGAAGAGAGAGGGGAGGG + Intergenic
949878599 3:8643980-8644002 CCGGTGGCGGGGAGTGGGGAGGG - Intronic
949943755 3:9174250-9174272 CTGGAGACAGATGGTGGTGATGG + Intronic
950480692 3:13241894-13241916 CAGGAGGCAGATGGTGGAGAAGG + Intergenic
950578609 3:13847875-13847897 CTGGAGATGGAAAGTGGGGATGG + Intronic
950702799 3:14761718-14761740 CTGAAGGGATGGAGTGGGGAGGG + Intronic
950905068 3:16530627-16530649 CTGGAGGCAGGGGGTGGGTTTGG - Intergenic
951355298 3:21659840-21659862 ATGTAGGCAGAGGGAGGGGAAGG - Intronic
951575887 3:24113655-24113677 ATGGAGGCTGGAAGTGGGGAGGG - Intergenic
951709321 3:25573186-25573208 CTGGAAGAACAGAGTGGGCAGGG - Intronic
951894752 3:27600238-27600260 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
951913647 3:27776990-27777012 CAGAAGCCATAGAGTGGGGAGGG + Intergenic
952590149 3:34942640-34942662 AGGGAGGCAGAGAGAGAGGAAGG - Intergenic
952853963 3:37752389-37752411 GTGGTGGCTGAGAGTGGGGGTGG - Intronic
953055888 3:39386947-39386969 CGAGAGGCTGAGAGTGTGGAGGG + Intronic
953125592 3:40088871-40088893 CTGGAGGCAGGAAGTCAGGAAGG + Intronic
953140013 3:40220796-40220818 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
953317329 3:41941140-41941162 CTGGAGGCTGAGAGAGGAGGAGG - Intronic
953367096 3:42354216-42354238 ATGGAGCCAGAGAGTGGGGATGG - Intergenic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953431775 3:42845985-42846007 GTGGAGGCTGAGGGTGGGGGTGG + Intronic
953602405 3:44379726-44379748 GGGGAGGGAGAGAGAGGGGAAGG + Intronic
953812418 3:46124739-46124761 CGGGGGGCAGTGAGTGGGGTTGG + Intergenic
953850939 3:46464977-46464999 CTGGCCGCGGGGAGTGGGGAGGG - Exonic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
953964534 3:47293190-47293212 CTGGAGACAGATAGTGGTGATGG + Intronic
954221924 3:49160222-49160244 TGGTAGGCAGAGAGTGGTGAGGG - Intergenic
954286744 3:49624862-49624884 CAGGAGGAAGAGGGTGGTGATGG + Intronic
954293083 3:49660036-49660058 CAGGAGGCATGGAGTGGAGAGGG - Intronic
954410917 3:50370529-50370551 CAGGAGCCAGAGAGAAGGGACGG + Intronic
954413956 3:50383817-50383839 TTGGGGGCAGGGAATGGGGAAGG + Intronic
954464314 3:50645793-50645815 ATGGAGGCAGGGGGTGGGGAAGG - Intronic
954710167 3:52501615-52501637 CTGGGGGCAGAGGGTGGGCAGGG - Intronic
955092681 3:55768039-55768061 AAGGAGGAAGAGAGTGGAGAAGG - Intronic
955108845 3:55927727-55927749 TTGGAGTCGGGGAGTGGGGATGG - Intronic
955349651 3:58184161-58184183 TTGGAGGCAGACAGCCGGGAGGG - Intergenic
955518624 3:59752731-59752753 CAGGAGGAAGAGAGAGTGGAGGG - Intronic
955935946 3:64102667-64102689 CTGGGGCCAGGGGGTGGGGATGG - Intronic
956027589 3:64999899-64999921 CTGGAGATAGATAGTGGTGATGG + Intergenic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956704936 3:71991534-71991556 AGGGAGGAAGAGAGAGGGGAGGG + Intergenic
956737251 3:72247282-72247304 CTGGAGGCAAAGCGTGGGTGGGG - Intergenic
957039647 3:75327449-75327471 GGTGAGGGAGAGAGTGGGGAGGG + Intergenic
957462364 3:80537912-80537934 AGGGAGGAAGAGAGAGGGGAGGG + Intergenic
957889707 3:86340700-86340722 GGGGAGGCAGAAGGTGGGGATGG - Intergenic
958642602 3:96827062-96827084 TTGATGCCAGAGAGTGGGGAAGG + Intronic
958733988 3:97988918-97988940 GTAGAGGTAGTGAGTGGGGATGG + Intronic
958755360 3:98245142-98245164 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
959530488 3:107430292-107430314 GTGAAGGCGGGGAGTGGGGAAGG + Intergenic
959591949 3:108091151-108091173 CTGGAGCCTGCGACTGGGGAGGG - Intergenic
959667983 3:108942836-108942858 CTGGAGGCATGGAGGAGGGAAGG - Intronic
959838430 3:110947879-110947901 CAGGAGCTAGAGAGTGGAGAGGG - Intergenic
959987198 3:112587470-112587492 CTGGAGGTAGACAGTGGTGATGG - Intergenic
960465840 3:117996479-117996501 AGGGAGGAAGAGAGTGGGGTGGG - Intergenic
960581315 3:119281607-119281629 CAGGAGAGAGAGAGTGGGCAGGG - Intergenic
960651335 3:119953847-119953869 CTGCAGGGAGAGATTGGTGATGG - Intronic
960811274 3:121629669-121629691 CTGGAGGGGGAGAGTGCGGCTGG - Exonic
960999697 3:123365878-123365900 CCAGAGGCAGAGGGAGGGGAGGG + Intronic
961477699 3:127158903-127158925 GTGGCTGGAGAGAGTGGGGACGG + Intergenic
961478184 3:127161635-127161657 CTCCAGGCAGAGAGAGGGGCAGG - Intergenic
961515175 3:127427778-127427800 CTGGAGCCAGTGATTGGGGTTGG - Intergenic
961670441 3:128524514-128524536 CTGGAGGGACTCAGTGGGGAGGG - Intergenic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
962304277 3:134272035-134272057 CTGGAGTCACAGAGTTGGAAGGG - Intergenic
962368095 3:134798877-134798899 CTGGACACAGGGAGTGGGGTTGG - Intronic
962375036 3:134852175-134852197 ATTGAGGCAGACAGTGGTGAGGG - Intronic
962637443 3:137345592-137345614 CTGGAGGCTGAGAGAGGAGAAGG + Intergenic
962671392 3:137712312-137712334 TGGGAGGTAGGGAGTGGGGACGG + Intergenic
962700906 3:137999112-137999134 CTGGAGGGAGAGATTGGAGGTGG + Intronic
962952398 3:140231249-140231271 CTGGAGCCAGGGAGACGGGAGGG - Intronic
962970435 3:140395970-140395992 CTGGAGGCAGAGACTTGGCCAGG + Intronic
963238851 3:142982910-142982932 CTGGAGCCAGAGAGTAGTGATGG - Intronic
963507064 3:146199681-146199703 ATGGAAGAAGATAGTGGGGAGGG - Intronic
964284309 3:155101082-155101104 CGGGAGGAAGAGAGTGGGTGGGG - Intronic
964358463 3:155870974-155870996 CTGGGGGAAGGGGGTGGGGAAGG - Intronic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
964674502 3:159262606-159262628 GAGGAGACAGAGGGTGGGGACGG - Exonic
964969503 3:162542249-162542271 ATGGAGGCAGACAGAGGGGAAGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965286845 3:166828272-166828294 CTGGACACAGAGACTAGGGAGGG + Intergenic
965349811 3:167598543-167598565 CAGGAGAAAGAGAGTGGGGTGGG - Intronic
965439621 3:168697228-168697250 ATGGAAGGAGAGAGAGGGGAAGG + Intergenic
965573915 3:170198478-170198500 CTGGAGTTAGACAGTGGTGATGG - Intergenic
965699062 3:171440709-171440731 CTGCAGGAAGAGGGTGTGGAGGG + Intronic
965726563 3:171723122-171723144 GTGGAGGGGGATAGTGGGGATGG - Intronic
965787650 3:172352876-172352898 CAGGACACAGAGAGTGGAGACGG - Exonic
966421226 3:179736401-179736423 CTGAAAGCAGAGAGTAGGCATGG + Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966754226 3:183353590-183353612 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
966803661 3:183788278-183788300 AGGGAGGGAGGGAGTGGGGATGG - Intronic
966942583 3:184756297-184756319 CTGGAGGTGGAGGGTGGGGTGGG - Intergenic
966984722 3:185168707-185168729 CTGGAGGCACAGAGAGGTTAAGG + Intergenic
967051327 3:185787197-185787219 CTGGAGATAGATAGTGGCGATGG + Intronic
967263835 3:187672515-187672537 CTTGAGGCAGAGACTGGGATAGG - Intergenic
967526763 3:190504053-190504075 GGAGAGGGAGAGAGTGGGGAGGG + Intergenic
967740366 3:192997182-192997204 CTGGACACAGAGACTAGGGAGGG - Intergenic
967805482 3:193711416-193711438 CTGGAGGCAGAAAGAGGGCAGGG + Intergenic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
968107135 3:196009268-196009290 CAGGGGGCAGGGTGTGGGGAGGG - Intergenic
968206532 3:196807206-196807228 CTGCAGGTAGAGTGTGCGGAAGG + Intronic
968361150 3:198147860-198147882 CTGGAGACAGACACTGGGCAGGG - Intergenic
968481800 4:836449-836471 CTGGAGCCAGAGAGCGGCGACGG + Intergenic
968597646 4:1493566-1493588 CTCCTGGCAGATAGTGGGGAGGG - Intergenic
968957401 4:3726299-3726321 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957407 4:3726323-3726345 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957413 4:3726347-3726369 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968996959 4:3951807-3951829 CTGGAGGGAGAGGGAGGAGATGG + Intergenic
969013944 4:4090576-4090598 CTGGAGACAGAGATTTGGGCGGG - Intergenic
969099440 4:4757712-4757734 TTGGAGGCCGAGGGTGGGGTTGG + Intergenic
969105862 4:4806679-4806701 CAGGAGGTAGAGAGAGGGGATGG + Intergenic
969209158 4:5673052-5673074 CTGTAAGCAGACAGTGGTGATGG + Intronic
969359563 4:6653953-6653975 CTTGAGGCAGATGGTGGTGATGG + Intergenic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
969621829 4:8282549-8282571 CAGGAGGCAGAGAGGGGCGAGGG - Intronic
969651256 4:8469604-8469626 CTGGAGATGGAGAGCGGGGATGG + Intronic
969680157 4:8638882-8638904 CTGCAGTTAGAGAGTGGTGATGG + Intergenic
969719066 4:8883094-8883116 CCTCAGGCAGAGAGTGGAGAGGG + Intergenic
969817004 4:9694448-9694470 CTGGAGGGAGAGGGAGGAGACGG - Intergenic
969861527 4:10039642-10039664 CAGGAGGATGACAGTGGGGATGG - Intronic
970110258 4:12629820-12629842 GTGGAGGGAGAGAGTGAAGAGGG + Intergenic
970155094 4:13133638-13133660 CTGGAGCCAGAGAGGTGGGACGG + Intergenic
970491433 4:16579004-16579026 CTGGAGATAGAGAGTGGGGATGG + Intronic
970509925 4:16771752-16771774 CTGGAGGCACAGAGAAGGGGTGG - Intronic
970759489 4:19467155-19467177 TTGGAGGCAGGGAGTGAGGGAGG + Intergenic
971376370 4:26058921-26058943 CAGCAGGCAGAAAGTTGGGATGG - Intergenic
971598836 4:28567574-28567596 CAGGAGAGAGAAAGTGGGGAAGG + Intergenic
971695090 4:29891270-29891292 CTGGAGGGTGGGACTGGGGAAGG - Intergenic
971766065 4:30833562-30833584 GTGGTGGCAGGGGGTGGGGATGG - Intronic
972025788 4:34375190-34375212 ATGGAAGGAGAGAGTGTGGATGG - Intergenic
972071252 4:35020989-35021011 TTGGGAGCAGAGAGTAGGGAGGG + Intergenic
972255957 4:37355513-37355535 CAGGAGGAAAAGAGTAGGGAGGG + Intronic
972364303 4:38359976-38359998 CAATAGGCACAGAGTGGGGATGG - Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
972406721 4:38753153-38753175 CTGGGGGTGGAGGGTGGGGAAGG + Intergenic
972741685 4:41893212-41893234 CTGGAGGGAGGGAGGTGGGAGGG - Intergenic
972817061 4:42656661-42656683 CTGGGGGCAGCGCGGGGGGAAGG + Intronic
972935665 4:44131846-44131868 CTGGAGGAAGGGAGAGTGGAGGG + Intergenic
973700168 4:53529305-53529327 CTGGGAGCAGGCAGTGGGGACGG + Intronic
973723087 4:53744842-53744864 CAGGAGCCAGGGAGTGGGGCTGG + Intronic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
974760278 4:66265999-66266021 AGGGAGGCAGTGAGTGGGCACGG + Intergenic
975083257 4:70305927-70305949 CAGGAGGCAGAGACTGTGGGGGG - Intergenic
975300090 4:72779990-72780012 CAAGAGAGAGAGAGTGGGGAGGG - Intergenic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
975832119 4:78380342-78380364 CTGGCGACAGAGAGAGAGGATGG + Intronic
976186722 4:82449506-82449528 CAGGAGCAAGAGAGTGGGGAGGG + Intronic
976206887 4:82631217-82631239 GAGGGGGCAGAGGGTGGGGAAGG - Exonic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976746048 4:88404008-88404030 CTGGGGGCGGAGAGAGGGAATGG - Intronic
977003830 4:91540164-91540186 TGGGATGTAGAGAGTGGGGAAGG - Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
978530205 4:109704519-109704541 ATGGAGGCTGAGAGAGGTGAGGG + Intergenic
978577719 4:110202798-110202820 CTTCAGGCTGAGAGTGGGCAGGG + Intergenic
978805788 4:112798904-112798926 CTGGAGACAGATAGTGGTAATGG - Intergenic
979813150 4:125064913-125064935 TTGGTGGCAGTGAGTAGGGAGGG - Intergenic
980021395 4:127714415-127714437 CAGGGGCCAGAGAGAGGGGAAGG - Intronic
980282101 4:130735960-130735982 CTGGAGTTGGAGAGAGGGGAGGG + Intergenic
980517999 4:133889755-133889777 GTGTAGGCTGAGAGTGGGGTGGG + Intergenic
980658259 4:135818258-135818280 CTGGAGATAGAGAGTGGTGATGG + Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
980888896 4:138793218-138793240 CAGGAGGAAGAGAGAGGGAAGGG - Intergenic
981011828 4:139933155-139933177 AAGGAGGGAAAGAGTGGGGAAGG + Intronic
981379522 4:144056899-144056921 ATTGAGGCAGAGAGAGGAGAAGG + Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
983077784 4:163345930-163345952 CTGGAGGCAGGGAGGGGGGGTGG - Intronic
983372565 4:166879895-166879917 CAGGAGGCAGAGAGAGAAGAGGG - Intronic
983798767 4:171901180-171901202 CTGGAGGTAGAGGGTGGGCAGGG - Intronic
983813475 4:172093633-172093655 CTGGAGGCAGAGCTCAGGGAAGG - Intronic
983933235 4:173475992-173476014 CTGGAAGCAGAAGGTGGTGATGG + Intergenic
983971682 4:173883038-173883060 CTGGGAGCAGAGTGTTGGGAAGG + Intergenic
984571725 4:181403485-181403507 CTGGAGACAGAGAGAGGGCAGGG + Intergenic
984731885 4:183076074-183076096 CTGGGGACAGAAAGTGGCGAAGG + Intergenic
984919225 4:184749271-184749293 CTGGAGGCTGAGGAAGGGGAGGG + Intergenic
984998791 4:185464349-185464371 CTTCAGTCAGAGGGTGGGGAGGG + Intronic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985324916 4:188756001-188756023 CTGGTGGCAGGGTGGGGGGAGGG + Intergenic
1202770857 4_GL000008v2_random:205617-205639 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
985747607 5:1655933-1655955 CTGGAGGCTGAGAGTCGGGCCGG - Intergenic
985963259 5:3319849-3319871 CTGGAGGCCCACAGTGGGGGCGG - Intergenic
986044100 5:4021152-4021174 CTGGAGATAGATGGTGGGGATGG - Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986199100 5:5565333-5565355 GAGGAGGCACAGAGTAGGGAGGG - Intergenic
986667996 5:10119646-10119668 CAGGAGGAAGAGAGATGGGAGGG - Intergenic
986822832 5:11486575-11486597 TTGGAGGGAGAGACAGGGGAAGG + Intronic
987279866 5:16402072-16402094 CTGAAGGCTGAGAGAGGTGAGGG - Intergenic
988271996 5:29028969-29028991 CTGAAGGTAGAGAATGGGGAGGG + Intergenic
988511711 5:31869843-31869865 CTGAGGGCAGAGAGAGGGGTGGG + Intronic
988593200 5:32567219-32567241 CAGGAGAGAGAGAGTAGGGAAGG - Intronic
988853496 5:35202495-35202517 AAGTAGGCAGAGAGTAGGGAGGG - Intronic
989445388 5:41522581-41522603 CAGGAGGGAGAGAGTGTGGTGGG + Intergenic
989665219 5:43846281-43846303 AGGGAGGGAGAGAGAGGGGAGGG - Intergenic
989779761 5:45249939-45249961 CTGCAGGGGGAAAGTGGGGATGG - Intergenic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990550312 5:56869373-56869395 CTGGAGACACATAGTGGTGATGG + Intronic
990565242 5:57021191-57021213 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
991028654 5:62058965-62058987 CTGGAGCAAGAGACTGGGGCAGG - Intergenic
991385129 5:66079107-66079129 CTGGAAGCAAAGAATGGGGATGG + Intronic
991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG + Intergenic
991501268 5:67279685-67279707 CTGAAGGCAGTCAGTGGGAATGG - Intergenic
991504178 5:67306819-67306841 TGGGAGTCAGGGAGTGGGGATGG + Intergenic
991538517 5:67700445-67700467 CTGGAGAGAGAGAGAGGAGAGGG - Intergenic
991655724 5:68902132-68902154 GTGGAGGAAGAGACTAGGGAAGG - Intergenic
991851005 5:70922502-70922524 CTGGAGTTAGATAGTGGTGATGG + Intergenic
992063013 5:73075640-73075662 CTGGGGGCAGAGGGTGCGGTGGG + Intronic
992388796 5:76311811-76311833 CTGGTGGCAGGGACTGGGGACGG - Intronic
992420307 5:76597296-76597318 CTGCAGGCAGAGGGTAGGTAAGG - Intronic
992843097 5:80715733-80715755 CAGGAGGAAGAGAGAGGGGGAGG + Intronic
992905139 5:81338427-81338449 CAGGAGGAAGAGAGAGGGGGAGG - Intronic
992962243 5:81967913-81967935 ATGGTGGCAGAGAGTAGGGTAGG - Intergenic
993701855 5:91128092-91128114 CAGGAGGCAGAGAGAGGGAGGGG - Intronic
993777974 5:92025765-92025787 CTGGAGGCAGAGATTGTTGTGGG + Intergenic
993883310 5:93388319-93388341 CGGGAGACAGATAGTGGTGATGG + Intergenic
993885163 5:93407581-93407603 CAGGAGGCTGAGGGTGGGGGTGG - Intergenic
994168317 5:96631186-96631208 CTGGAGTTAGATAGTGGTGATGG - Intronic
994559425 5:101347942-101347964 CAAAAGGCAGAGATTGGGGAGGG + Intergenic
995071455 5:107926703-107926725 ATGGAAGAAGAGAGTTGGGAAGG + Intronic
996232969 5:121088507-121088529 CAGGAGGAAGAGAGAGGGAAGGG + Intergenic
996605637 5:125318320-125318342 CTGGAAACGGAGAGTGGTGATGG - Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
997032296 5:130144994-130145016 CAGGAGGAAGAGAGAGGGAAGGG + Intronic
997096932 5:130923861-130923883 CTGGAGCCAGGGAGTCTGGATGG + Intergenic
997157118 5:131572995-131573017 CTGGGAGCAGAGACTAGGGAGGG - Intronic
997205628 5:132047507-132047529 CTGGAGGTAGATGGTGGTGATGG - Intergenic
997425309 5:133798991-133799013 AGGGAGGGAGAGAGAGGGGAAGG + Intergenic
997496027 5:134326995-134327017 CACCAGGCAGAGAGTGGGGAAGG - Intronic
997831727 5:137156166-137156188 CTGAACCCTGAGAGTGGGGAGGG + Intronic
997862703 5:137432654-137432676 CTGGAGCTAGACAGTGGTGATGG + Intronic
997938693 5:138137235-138137257 GTGGAGTCCGAGAGTAGGGATGG - Intronic
998142064 5:139705656-139705678 CTGGGGGGAAAGAGAGGGGAGGG - Intergenic
998272716 5:140721441-140721463 CTGGAGATAGATAGTGGTGATGG - Intergenic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999321255 5:150616519-150616541 GTGGAGGCAAAGGGTGGAGATGG - Intronic
999392084 5:151200591-151200613 ATGGAGGCAAAGAGAGGTGAAGG + Intronic
1000122317 5:158209009-158209031 CTGAGGGCAGAGAGTGGAGAGGG + Intergenic
1000400290 5:160818999-160819021 CTGGGGGGTGGGAGTGGGGACGG + Intronic
1000661888 5:163948344-163948366 CTGGAGGCAGGGATCGGGCAGGG + Intergenic
1000794457 5:165647561-165647583 CAGGAGGAAGAGAGCAGGGATGG + Intergenic
1000970218 5:167705797-167705819 CTAGAAGCAGAGAGTAGGAATGG - Intronic
1001066406 5:168538237-168538259 CTGGAGGCAGTGGGATGGGAAGG - Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001123400 5:168997980-168998002 ATGGAGGGAGAGAGAGGGCATGG - Intronic
1001310310 5:170605507-170605529 CTGGAACCAGATAGTGGTGATGG - Intronic
1001412751 5:171522433-171522455 ATGGAGGCACAGAGAGGGGAAGG - Intergenic
1001667651 5:173446725-173446747 CTGGAGGAAGAGAGAGGTGATGG + Intergenic
1001822078 5:174718349-174718371 GTGGAGGCAGAAAGGGAGGAGGG + Intergenic
1001973601 5:175978399-175978421 CTGGAGACAGATGGTGGTGATGG + Intronic
1002050467 5:176567867-176567889 CGGGAGGCTGAGATGGGGGATGG - Intronic
1002165679 5:177343843-177343865 CTGGAGACAGACGGTGGTGATGG + Intronic
1002243832 5:177865380-177865402 CTGGAGACAGATGGTGGTGATGG - Intergenic
1002289353 5:178188979-178189001 GTGGGGGCAGAGATTGGCGAGGG + Intergenic
1002309475 5:178306015-178306037 CTGGAGGCAGGGAGAGGACATGG + Intronic
1002316493 5:178347484-178347506 CTGGAATCAGACAGTGGTGACGG + Intronic
1002345714 5:178546465-178546487 CTGGGAGCAGAGAGGAGGGAGGG - Intronic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002453231 5:179331395-179331417 CTGGAGGGAGAGGAGGGGGAAGG + Intronic
1002610296 5:180413405-180413427 CTTGATGCAAAGAGTGGAGACGG + Intergenic
1002816182 6:682722-682744 ATGGATGCAGAAAGTGGGAAAGG + Intronic
1003403493 6:5809836-5809858 GAGGAGGCAGAGAGAGGGGAAGG + Intergenic
1003405477 6:5824017-5824039 CTGGAAGCAGAAAGTGAGGTCGG - Intergenic
1003479782 6:6520302-6520324 GTGGAGGGAGAAAGTGGGGGAGG + Intergenic
1003503407 6:6721102-6721124 CTGGAGGCAGATGGTGTTGATGG + Intergenic
1003503751 6:6723738-6723760 ATGGAGGCAGAAAGTGGAGAAGG - Intergenic
1003822718 6:9917927-9917949 CTGAAGGCTGAGAGTAGGGAAGG - Intronic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1003926488 6:10882207-10882229 CTGCAGCCAGAGGGTGGGGGTGG + Intronic
1003967408 6:11266244-11266266 CTGGAGTAAGTGAGGGGGGAGGG - Intronic
1004106143 6:12668910-12668932 CTGGGCACAGAGACTGGGGAGGG - Intergenic
1004428167 6:15520198-15520220 CTGGAGGCTGACAGACGGGAGGG - Exonic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004518769 6:16342929-16342951 CTGGAGACAGATGGTGGTGATGG + Intronic
1004596755 6:17106215-17106237 ATGGTGGCAGAGGTTGGGGATGG - Intronic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1004987581 6:21100106-21100128 CAGGGGACAGAGAGTGGGGGTGG - Intronic
1005080442 6:21951917-21951939 GTGGAGGAGGAGAGTGGAGATGG + Intergenic
1005613548 6:27550344-27550366 CTGGAGATAGATGGTGGGGATGG - Intergenic
1006088918 6:31616321-31616343 CTGGGGGCAGAGGATGGGGATGG - Intronic
1006095198 6:31651977-31651999 CTGGAGGACGAGAGGTGGGAGGG + Intronic
1006246268 6:32739556-32739578 CAGAAAGCAGGGAGTGGGGATGG + Intergenic
1006320881 6:33318717-33318739 CTGGAGGCAGGGAGAAGGGGAGG + Exonic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1007007346 6:38378119-38378141 CAGGAGGCAGATAAGGGGGAGGG - Intronic
1007226912 6:40321552-40321574 AGGCAGGCAGGGAGTGGGGATGG + Intergenic
1007272908 6:40651771-40651793 CTGGAGGAAGAACCTGGGGAGGG - Intergenic
1007290878 6:40785821-40785843 CTGGGAGCAGTGAGTGGGGATGG - Intergenic
1007301223 6:40869359-40869381 CAGGACTCAGAGAGTGAGGAGGG + Intergenic
1007378516 6:41471894-41471916 GAGGAGGCAGGGAGTGGGGAGGG + Intergenic
1007690991 6:43701267-43701289 CTGGAGATAGAAGGTGGGGATGG - Intergenic
1007703205 6:43776212-43776234 TTGGAGGCCTAGAGAGGGGAGGG + Intronic
1007722450 6:43893127-43893149 CGTGAGGCAGAGAGAGGGGCTGG + Intergenic
1007742632 6:44022066-44022088 CAGGAGCCAGAGTCTGGGGATGG + Intergenic
1007748855 6:44059666-44059688 CTTGAGGCAGGGCGTTGGGAAGG + Intergenic
1008018357 6:46547098-46547120 ATGGTGGCAGAGGGTGGGGTGGG + Intergenic
1009269277 6:61598087-61598109 CTTGTGGCAGGGAGTGGGGTGGG - Intergenic
1010083236 6:71887261-71887283 CTCGCGGCTGAGTGTGGGGAAGG + Intronic
1010765966 6:79777644-79777666 CTGGAGACGGACAGTGGCGATGG + Intergenic
1011129362 6:84037807-84037829 GTGGAGGGAGAGAGAGGGGCAGG - Intronic
1011414281 6:87101354-87101376 AAGGAGGCAGAGAAAGGGGAGGG - Intergenic
1012054785 6:94392731-94392753 CTGGATTCAGAGAGAGGGGAAGG - Intergenic
1012381044 6:98619862-98619884 GTGGGGGTAGAGGGTGGGGATGG - Intergenic
1012852724 6:104466393-104466415 ATGAAGGCAAAAAGTGGGGAGGG - Intergenic
1013177688 6:107691297-107691319 GTGGAGGCGGGGAGGGGGGAGGG - Intergenic
1013376276 6:109518041-109518063 GTGAAGGCAGACAGTGGAGAGGG - Intronic
1013652081 6:112205797-112205819 CTGGAGGTTGGGGGTGGGGAGGG - Intronic
1013714143 6:112937549-112937571 CAAGAGGGAGAGAGAGGGGAAGG - Intergenic
1014115465 6:117663901-117663923 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1014214145 6:118736748-118736770 CTGGAGCCAGAGGCTGGGGCTGG + Intergenic
1014701933 6:124699615-124699637 CAGCAGCAAGAGAGTGGGGAAGG - Intronic
1015358184 6:132305176-132305198 CTGGAGCCAGAGAGGCTGGATGG + Intronic
1015481054 6:133710264-133710286 ATGGAGGAAGAGAGAAGGGAAGG + Intergenic
1015933864 6:138388722-138388744 GTGGAGGTAAAGTGTGGGGAAGG - Intergenic
1016013654 6:139163177-139163199 CTGGAGACATTGAGTGGGGCTGG + Intronic
1016167253 6:140962106-140962128 CTCGAGGGAGAGGGTGGGGGTGG - Intergenic
1016223054 6:141699318-141699340 CTGAAGGAGGAGAGTGGGAAGGG + Intergenic
1016581644 6:145634732-145634754 CTGGAGGAAGAGTGAGTGGAGGG - Intronic
1016772748 6:147870349-147870371 TTGGAGGCAGGGAATGGGGATGG - Intergenic
1017138571 6:151169833-151169855 CTGGAGGTGGATAGTGGTGATGG - Intergenic
1017245140 6:152216567-152216589 CTGGAGGGAGAGAGTGGCTATGG + Intronic
1017269691 6:152491709-152491731 CTGGGAGCAGAGACTAGGGAGGG - Intronic
1017491144 6:154946221-154946243 CCAGAGGCTGGGAGTGGGGAAGG - Intronic
1017717861 6:157224643-157224665 TTGGAGGGGGTGAGTGGGGAGGG + Intergenic
1017718406 6:157228149-157228171 CTGGACCCAGGGAGTGTGGAGGG + Intergenic
1017907949 6:158769638-158769660 CTGAAGGCAGCTGGTGGGGAAGG - Intronic
1017985646 6:159441147-159441169 CTGCAGCCAGAGACTGGGAATGG - Intergenic
1018033965 6:159866395-159866417 CTGGAGTCTGAGCATGGGGAGGG - Intergenic
1018234513 6:161710940-161710962 AGGGAGGGAGGGAGTGGGGAAGG - Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1019230491 6:170557093-170557115 CAGGAGGGAGAGAATAGGGAGGG + Intronic
1019254537 7:40861-40883 CTGGAGACAGACACTGGGCAGGG + Intergenic
1019329469 7:455492-455514 CTGGACGCAGGACGTGGGGACGG + Intergenic
1019616906 7:1967698-1967720 GTGGTGCCAGAGAGTGAGGAAGG + Intronic
1019697306 7:2452721-2452743 GGGGAGGGAGGGAGTGGGGAGGG - Intergenic
1019764148 7:2837190-2837212 CACGAGGCAGAAAGAGGGGATGG + Intronic
1019779223 7:2929808-2929830 CTGGAGGGAGAGAGGGTGGTGGG + Intronic
1019973850 7:4564041-4564063 GTGGAGGAAGAGAGTGTGCAGGG - Intergenic
1020087714 7:5320518-5320540 CAGGAGGCGGTGAGGGGGGAGGG - Exonic
1020321251 7:6940189-6940211 CTGGAGGGAGAGGGAGGAGACGG + Intergenic
1020412974 7:7913751-7913773 CTAGAGGGAGAGAGTTGGGGAGG + Intronic
1021131611 7:16919259-16919281 CTGGAACTAGAGAGTGGTGATGG - Intergenic
1021393497 7:20122102-20122124 CTGGGGACAGAGACTAGGGAGGG - Intergenic
1021946744 7:25735192-25735214 CTGGAGGATGGGAGTGGGGAAGG - Intergenic
1022064515 7:26837491-26837513 CAAGAGACAGAGAGTGGGGTTGG + Intronic
1022142066 7:27501068-27501090 CTGGGGGCAGTGAGCAGGGACGG + Intergenic
1022311649 7:29201946-29201968 CTGGAGGATGATATTGGGGAGGG + Intronic
1022423659 7:30247080-30247102 CTGGTGGCAGGGGGTGTGGAGGG + Intergenic
1022483555 7:30759991-30760013 CTGGAAGGAGAGAGTGGGCAAGG + Intronic
1022502486 7:30891525-30891547 ATGGGGACAGAGGGTGGGGAGGG - Intronic
1022630488 7:32079882-32079904 CTTGATGCAGGGTGTGGGGAGGG + Intronic
1022689838 7:32637963-32637985 CTGAAGGCACAGAGTGGGAGGGG - Intergenic
1022917418 7:34972196-34972218 CTGAAGGCACAGAGTGGGAGGGG - Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023610648 7:41967187-41967209 CTGGGGACTGACAGTGGGGAGGG + Intronic
1023635369 7:42204199-42204221 ATGGAGGCAGAGAATGTGAATGG - Intronic
1023872499 7:44270305-44270327 CTGGAAGCAGTGGCTGGGGAGGG + Intronic
1023965673 7:44962079-44962101 CTGGAGGCTGAGGCTGGGGTAGG + Intergenic
1024099489 7:46015712-46015734 CTGGAGCCAGGGAGGGTGGACGG + Intergenic
1024268458 7:47624495-47624517 CTGGAGGCACTCAGTGGGGGAGG - Intergenic
1024598022 7:50956178-50956200 CAGGACGCAGAGGGAGGGGAAGG + Intergenic
1024941399 7:54767052-54767074 CTGGTTGCAGAGAGTGGCCATGG + Intergenic
1024957037 7:54933266-54933288 CTGGTGGCAGAGAGGGAGGGAGG + Intergenic
1025820019 7:64954403-64954425 CTGGAGGCTGAGGGAGGAGAAGG + Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1026121114 7:67538615-67538637 CAGGAGGAAGAAAGTGGGGGTGG - Intergenic
1026215207 7:68342468-68342490 CTGAAAGCTGAGAGTGGGGGTGG - Intergenic
1026254244 7:68697026-68697048 CAATAGGCAGAGAGTAGGGATGG + Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026362723 7:69617531-69617553 GAGGGGACAGAGAGTGGGGAGGG + Intronic
1026388942 7:69880158-69880180 CAGGAGGAAGAAAGTGGGGGTGG + Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026840768 7:73668859-73668881 CTGGAGGCAGAGGAAGGGGTGGG + Intronic
1027268104 7:76504997-76505019 CTGGAGGCGGGGAGAGGGCAGGG + Intronic
1027341288 7:77210827-77210849 CAGGAGGGAGAGAGTGTGAAAGG + Intronic
1027840481 7:83305057-83305079 ATGGAGGCAGGGAGTGGGTATGG - Intergenic
1028398844 7:90403297-90403319 GTGGAGGCAGAGAAAGGGAAGGG + Intronic
1028486376 7:91362395-91362417 TCGGGGGCAGGGAGTGGGGAGGG + Intergenic
1029341261 7:99946497-99946519 CTGGAGCCAGGTGGTGGGGATGG + Intergenic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029413980 7:100431534-100431556 CCGGGGGCAGAGGGTGAGGAAGG + Exonic
1029456490 7:100674776-100674798 CTGGAGGAAGAAACTGGGGGCGG - Intronic
1029551148 7:101237737-101237759 AGGGAGGCAGAAAGTGGAGACGG - Exonic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1030097268 7:105911437-105911459 CTGGAACCAGATAGTGGTGATGG + Intronic
1030163735 7:106532618-106532640 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1030202196 7:106917136-106917158 TTGGAGACAGAGAGTAGGGTTGG + Intergenic
1030412607 7:109200808-109200830 CAGGAGGCAGAGATTGCGGTGGG - Intergenic
1030658765 7:112196634-112196656 CTGGTGACAGAGAGTGGGGAAGG + Intronic
1030779942 7:113587875-113587897 CTGGATGTTGATAGTGGGGAAGG - Intergenic
1030887368 7:114954912-114954934 ATAGAGGCAGAAAGTGGTGAGGG - Intronic
1030888701 7:114970648-114970670 TTAAAGGCAGTGAGTGGGGAAGG + Intronic
1031482966 7:122300418-122300440 CTGGAGGGAGAGAGTGGGCCGGG + Intergenic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1031900847 7:127409092-127409114 CTGAAATCAGATAGTGGGGATGG - Intronic
1032081455 7:128860508-128860530 AGGGGGGCAGAGAGTGAGGATGG - Intergenic
1032268481 7:130384282-130384304 CGGGTGAAAGAGAGTGGGGAAGG - Intronic
1032319248 7:130870233-130870255 GTGGAGTTAGAGAGTGGTGATGG + Intergenic
1032392195 7:131562591-131562613 ATGGAGGCAGCGAGTGTGGATGG + Intergenic
1032441767 7:131947595-131947617 CAGGAGGGAGAGGGTGGGGCAGG + Intergenic
1032624725 7:133579562-133579584 CTGGAGACAGATGGTGGTGATGG - Intronic
1033393615 7:140952333-140952355 CTGGAGTTAGATAGTGGTGATGG + Intergenic
1033527681 7:142232595-142232617 GGGGAGCCAGAGAGGGGGGATGG + Intergenic
1033600658 7:142886127-142886149 GGGGAGGCAGAGAGTGAGGCAGG - Intergenic
1034024869 7:147690014-147690036 CTGGAGGCGGAATTTGGGGAGGG - Intronic
1034117478 7:148596802-148596824 GGGGAGGAAGGGAGTGGGGAAGG - Intronic
1034188580 7:149196893-149196915 CTTGAGTCAGAGAGTGGGGCTGG + Intronic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1034743338 7:153498704-153498726 GTGGAGGCTGAGAGAGGTGAGGG + Intergenic
1034960944 7:155364007-155364029 CTGCAGGCAGAGAAAGGGGCAGG - Intronic
1035074594 7:156169360-156169382 CGGGAGGCAGTGTGTGGGGTGGG + Intergenic
1035757604 8:2045828-2045850 CTGGAGAAAGACAGTGGGGCTGG + Intronic
1036212303 8:6852326-6852348 CTGTAGGGAGAGAAAGGGGAGGG + Intergenic
1036380274 8:8232188-8232210 CTGGAGGGAGAGGGAGGAGACGG - Intergenic
1036405155 8:8448156-8448178 CAGAAGGCAGAGGGTAGGGAGGG + Intergenic
1036425406 8:8641393-8641415 CTGGAGGCAGAGTGTGTAGGAGG - Intergenic
1036430010 8:8681313-8681335 CTGGAGGCAGAGGGAGGAGTGGG + Intergenic
1036666389 8:10745445-10745467 CTGGAGGTAGATGGTGGTGATGG - Intronic
1036941085 8:13052912-13052934 CTGGAGGTAGATTGTGGTGATGG - Intergenic
1037475319 8:19251458-19251480 CAGGACTCAGAGAGTGGAGAGGG + Intergenic
1037651565 8:20843611-20843633 CTGGAGGCAGAAAATGGGCCAGG + Intergenic
1037883651 8:22585305-22585327 CTGGAAGCTGAAAGTGGGAAAGG - Exonic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1037940618 8:22948213-22948235 GTGGATGCAAAGTGTGGGGAAGG + Intronic
1038368527 8:26962787-26962809 CTGAGGGGAGAGAGTGGGAAGGG - Intergenic
1038697464 8:29819029-29819051 CTGCAGGCAGGTAGTGTGGAGGG - Intergenic
1038790975 8:30668037-30668059 CAGGAGGCAAAGAGAGTGGAAGG - Intergenic
1039957145 8:42216329-42216351 CAGGAGGCAGGGAGCTGGGAGGG + Intergenic
1039982581 8:42420788-42420810 CTGGAGACAGATTGTGGTGATGG - Intronic
1040675850 8:49749307-49749329 CTGGAGATGGACAGTGGGGATGG + Intergenic
1041098120 8:54369833-54369855 AGGGAGGGAGAGAGGGGGGAGGG - Intergenic
1041494760 8:58473310-58473332 CTGGAGGTAGATGGTGGTGATGG - Intergenic
1041741148 8:61158311-61158333 CTGGAGGAACAGACTGGGAAGGG + Intronic
1042252113 8:66766923-66766945 CGGGAGGCAGAGATTGCGGTGGG - Intronic
1042346786 8:67735893-67735915 CTGGAGGGAGAGGGGAGGGAAGG - Intronic
1042820703 8:72927052-72927074 CAGGAGGCATGGAGTGGGGCCGG + Intronic
1043283582 8:78501356-78501378 CAGGAGGCAGAGAGAGAGCAAGG + Intergenic
1043383709 8:79728724-79728746 CAGGAGGAAGAGAGTGAGGGGGG - Intergenic
1044009474 8:86975386-86975408 CTGGAAGCTGAAGGTGGGGATGG - Intronic
1044481806 8:92699334-92699356 TTGTAGGCATAGAGTGGGGGAGG + Intergenic
1044489836 8:92800534-92800556 CTGGCGACAGAGTGTGGGGGTGG - Intergenic
1044610684 8:94088894-94088916 ATGGAGGCAGAGACTGGAGCAGG - Intergenic
1045009961 8:97950435-97950457 TTAGAGGTAGAGAGTGGGGCAGG + Intronic
1045117336 8:98997553-98997575 CTGGAGGAAGACAGAGGAGAGGG + Intergenic
1045547338 8:103140687-103140709 TTGGAGGCGGAGAGGAGGGACGG + Intronic
1046204167 8:110968481-110968503 CGGGAGGGAGAAAGTGGGGATGG - Intergenic
1046230151 8:111345387-111345409 AGGGAGACAAAGAGTGGGGAGGG + Intergenic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047336334 8:123940216-123940238 CAGGAGGCAGAGCATGGGGGAGG + Intronic
1047537346 8:125731957-125731979 CTGGAGACGGAGACGGGGGAGGG + Intergenic
1048577730 8:135706230-135706252 ATGGAGGGAGAGTGTGGGGGAGG + Intergenic
1048680845 8:136839991-136840013 AGGGAGGCAGAGAATGGGGCAGG + Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1048857011 8:138694439-138694461 CTGGAGCGAGAGAGTGTGGCTGG + Intronic
1048899161 8:139021720-139021742 TTGGAGGCAGAGATTGGGCTGGG + Intergenic
1049014119 8:139907554-139907576 ATGGAGGCAGAGAGGGAGGGAGG + Intronic
1049150956 8:141035200-141035222 CTGGAGGCAGAGATTGGAGTGGG + Intergenic
1049262121 8:141645517-141645539 CTGCAGGGAGGGAGTGGGGAGGG - Intergenic
1049361941 8:142216106-142216128 GGGGCGGCAGGGAGTGGGGAAGG - Intronic
1049587443 8:143438593-143438615 CTGGAGGCAGGCAGTGTGGAGGG + Intronic
1050057270 9:1668762-1668784 CTGGAGGAGGATAGTGGGGGTGG + Intergenic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1050357751 9:4799036-4799058 GGGGAGGGAGAGAGGGGGGAAGG - Intronic
1050403879 9:5286519-5286541 CTGGAGATAGATAGTGGTGATGG + Intergenic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1050929820 9:11308743-11308765 CAGGAGGCAGATAAGGGGGAGGG + Intergenic
1051003873 9:12318201-12318223 CTGGATGGAGAGAGTAGGGTAGG - Intergenic
1051173478 9:14342449-14342471 CGGGAGGCAGGGAGGAGGGAAGG + Intronic
1051336580 9:16071134-16071156 AGGGAGGCAGAGAGAGGAGATGG + Intergenic
1051818212 9:21134235-21134257 CCAGAGACAGAGAGTGGGCAGGG - Intergenic
1052721210 9:32173205-32173227 CTGGAGGCAGAGAGAAGGGAGGG - Intergenic
1052834379 9:33239808-33239830 CAGGAGGCAGAGAAGGGGGCTGG - Intronic
1052886693 9:33656196-33656218 ATGGAGTCAGAGATGGGGGAGGG - Intergenic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1053078585 9:35155423-35155445 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1053553330 9:39107296-39107318 AGGGAGGGAGGGAGTGGGGAAGG + Intronic
1053800944 9:41764267-41764289 CGGGATGTAGAGAGTGGGGTGGG + Intergenic
1053817439 9:41927457-41927479 AGGGAGGGAGGGAGTGGGGAAGG + Intronic
1054107689 9:61071108-61071130 AGGGAGGGAGGGAGTGGGGAAGG + Intergenic
1054189375 9:61976417-61976439 CGGGATGTAGAGAGTGGGGTGGG + Intergenic
1054355182 9:64054070-64054092 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1054613168 9:67260017-67260039 AGGGAGGGAGGGAGTGGGGAAGG - Intergenic
1054896026 9:70312284-70312306 CAGGAGAGAGAGAGTGGGCAGGG + Intronic
1055986887 9:82061986-82062008 CTGGATGCAGAGAGGGGTGAGGG - Intergenic
1056084644 9:83134184-83134206 CAGGTGGCTGAGAGTAGGGAGGG - Intergenic
1056096722 9:83262241-83262263 TTGGAGGTAAAGAGTTGGGAGGG - Intronic
1056157149 9:83849878-83849900 CTGGAGGCAGGCAGAAGGGATGG + Intronic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056330383 9:85516415-85516437 CTGGGGGCTGGGAGTGGGGCAGG + Intergenic
1056353389 9:85774235-85774257 CTGGAGGCAGGCAGAAGGGATGG - Intergenic
1056681258 9:88721134-88721156 CTGGGGGAGGAGAGTGGGGCTGG - Intergenic
1057037853 9:91824780-91824802 CTGGTTCCAGAGCGTGGGGACGG - Intronic
1057365128 9:94412900-94412922 CTGGAGTTAGATAGTGGTGATGG + Intronic
1057658196 9:96975190-96975212 CTGGAGTTAGATAGTGGTGATGG - Intronic
1058187248 9:101869487-101869509 CTAGAAGCAGAGACTGAGGAGGG - Intergenic
1058447200 9:105064618-105064640 CTGGAGACAGTGAGTGTGGTTGG + Intergenic
1059053362 9:110952845-110952867 CTGGAGGTAGACAGTGGAGCTGG - Intronic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1059320038 9:113462290-113462312 TTGGAGGGGGAGAGTGGGGTGGG + Intronic
1059342056 9:113602856-113602878 CTGGGGGTAAAAAGTGGGGATGG - Intergenic
1059451141 9:114372159-114372181 CTTGAGGCTGAGAGAGGGGTTGG + Intronic
1060096312 9:120793505-120793527 CTGGAGGCCGGGAGTAGGGGTGG + Intergenic
1060188094 9:121576028-121576050 CTGGAGACGGAGAGTCGGGGTGG - Intronic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060483833 9:124034479-124034501 GTGGAGGGAGTGAGTGGGGCAGG + Intergenic
1060505089 9:124191780-124191802 CAGGAGGCAGCCAGTGGGGCTGG + Intergenic
1060556035 9:124507577-124507599 CTGGGGGCTGAGGGTGGGGGCGG + Intergenic
1060809322 9:126601759-126601781 CTGGAGACAAATAGTGGTGATGG + Intergenic
1061163608 9:128910078-128910100 GTGGAGGCAGGCAGTGTGGATGG + Intronic
1061168601 9:128939028-128939050 ACTCAGGCAGAGAGTGGGGATGG - Intronic
1061275396 9:129567128-129567150 CTGGAGGCAGAGAATGCCGGAGG - Intergenic
1061716873 9:132523892-132523914 CTGGAGCCTGGGAGTGGGGGTGG - Intronic
1061724983 9:132577338-132577360 AGGGAGGGAGTGAGTGGGGAGGG + Intergenic
1061796361 9:133087868-133087890 TTGGAAGCAGAGGATGGGGAGGG + Intergenic
1061897352 9:133655365-133655387 GTGGTGGCAGAGGGTGGGGAGGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062254210 9:135613501-135613523 AGGGAGGGAGGGAGTGGGGAAGG + Intergenic
1062254583 9:135614936-135614958 GTGGGGGCAGCAAGTGGGGAAGG + Intergenic
1062374531 9:136255945-136255967 CAGGTGGCAGAGAGGGGGGTGGG + Intergenic
1062413106 9:136434574-136434596 CAGGAGGGTGAGAGTGGGTAAGG - Intronic
1062430508 9:136525031-136525053 CTGGGGGCTGAGCGTGGGCAGGG - Intronic
1062522930 9:136966148-136966170 CGGGAGGAAGAGAATGGGGGCGG - Intergenic
1062582075 9:137233184-137233206 GTGGCCGCAGAGAGTGGGCAGGG - Intronic
1062601422 9:137320217-137320239 CTGGGGGCAGGACGTGGGGAAGG - Intronic
1062640775 9:137517132-137517154 GTGGAGTGAGTGAGTGGGGATGG - Intronic
1062640915 9:137517940-137517962 GTGGAGTGAGTGAGTGGGGATGG - Intronic
1062745862 9:138211692-138211714 CTGGAGACAGACACTGGGCAGGG - Intergenic
1203737499 Un_GL000216v2:150634-150656 CTGTAGGCAGAGAGTGGAAAAGG + Intergenic
1203743510 Un_GL000218v1:23175-23197 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1203703792 Un_KI270742v1:18136-18158 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1203566602 Un_KI270744v1:96344-96366 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
1185604667 X:1361176-1361198 ATGGAGAGAGAGAGAGGGGAAGG - Intronic
1186112994 X:6276372-6276394 CTGGGGACAGAGACTAGGGAGGG + Intergenic
1186145008 X:6615950-6615972 CAGGAGGAAGAGAGTGTGAAGGG - Intergenic
1186158975 X:6756485-6756507 CTGGAAATAGATAGTGGGGATGG + Intergenic
1186168586 X:6853553-6853575 CTGGAAGTAGATAGTGGTGATGG - Intergenic
1186224160 X:7379326-7379348 ATTGAGGTGGAGAGTGGGGAGGG + Intergenic
1186413721 X:9365314-9365336 CTGGAGGTAGATGGTGGTGATGG - Intergenic
1186625461 X:11288583-11288605 CTGGAGTTAGACAGTGGTGATGG - Intronic
1187492090 X:19761350-19761372 GAGAAGGGAGAGAGTGGGGAGGG + Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1187660003 X:21534095-21534117 CTGGAGGCTGAGAATGGGAGGGG - Intronic
1188142240 X:26565766-26565788 TTGGAGGTAGAGAAAGGGGAGGG + Intergenic
1188153086 X:26703703-26703725 ATGGAGGTAGAGGGTGGGAAAGG + Intergenic
1188346522 X:29073122-29073144 CTGGAGGCAGATATAGGTGAGGG - Intronic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1189136684 X:38557823-38557845 CTGGAGCTAGATAGTGGTGATGG - Intronic
1189383564 X:40518858-40518880 CTGGTGGAATAGGGTGGGGAGGG + Intergenic
1189803781 X:44715779-44715801 CTTGAGGGAGAGACTGGTGAAGG + Intergenic
1189922032 X:45911818-45911840 CTGGTGACAGACAGTGGAGAAGG + Intergenic
1189972734 X:46434492-46434514 CAGGAGTCAGAAGGTGGGGAGGG - Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190026672 X:46930235-46930257 CTGGAGGAAGAGAGATGGTATGG + Intronic
1190050448 X:47145348-47145370 CTGGAGGCAGATCGGGGGGAGGG - Exonic
1190063327 X:47224362-47224384 CTGGTGGCAGGGAGAGGGGTAGG - Intronic
1191047335 X:56152649-56152671 GTGAAGGTAGAGAGAGGGGAAGG + Intergenic
1191102049 X:56740965-56740987 GTGGTGGGGGAGAGTGGGGATGG - Intergenic
1191700058 X:64032890-64032912 CTGGAGGAATAGAGTGGTGGAGG - Intergenic
1192137109 X:68613489-68613511 CTGGAGGTAGAGAGAGGATAGGG + Intergenic
1192156029 X:68747237-68747259 CTGGAGGGAGGAAGTGGGGCAGG + Intergenic
1192163435 X:68806752-68806774 CTGGAGCTAGATAGTGGTGATGG + Intergenic
1192179151 X:68905147-68905169 CTGAAGCCAGAGAGAGGGGAAGG - Intergenic
1192340571 X:70260095-70260117 CTGTAGGCAGGCAGTGGGGAAGG - Intergenic
1192442313 X:71183592-71183614 CTGGAAGCAGAAACTGGGGAGGG - Intergenic
1192550560 X:72050057-72050079 CTGGAGGGAGAGAGAGGAGGAGG - Intergenic
1192602354 X:72478446-72478468 ATGGAGGAATAGAGAGGGGAGGG - Intronic
1192930263 X:75799319-75799341 CTGGAGCCAGAGAGGCTGGACGG - Intergenic
1194650015 X:96503344-96503366 AGGGAGGGAGGGAGTGGGGAAGG + Intergenic
1194680298 X:96843808-96843830 CAGGAGGCAGATAACGGGGAGGG - Intronic
1195218017 X:102719585-102719607 CTGGAGCTAGATAGTGGTGATGG + Intergenic
1195570837 X:106397001-106397023 CTGCAGGCACCGAGTGGAGAGGG + Intergenic
1195900523 X:109792891-109792913 CTTGGGGGAGAAAGTGGGGAAGG - Intergenic
1195903377 X:109821235-109821257 CTGGAGATAGACAGTGGCGATGG - Intergenic
1195995948 X:110731871-110731893 CTGGAGTTAGATAGTGGTGATGG + Intronic
1196382314 X:115104212-115104234 CAGGAGGTAGGGAGTGGGGAGGG + Intergenic
1196584997 X:117419159-117419181 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
1196705488 X:118713891-118713913 CTGGAGACAGATGGTGGTGATGG - Intergenic
1197192963 X:123669391-123669413 CGGGAGGCAGAGATTGCGGTGGG - Intronic
1197812857 X:130463537-130463559 CTGGGGGCTGAGGGTGGGGATGG - Intergenic
1198312120 X:135434017-135434039 CTGGAGACAGAGGATGGAGAGGG + Intergenic
1198444973 X:136704251-136704273 CTGGAGCTAGACAGTGGTGATGG + Intronic
1198503932 X:137282108-137282130 GGGGAGGCAGTGAGTGGGAAGGG + Intergenic
1198632830 X:138660733-138660755 GGTGAGGCAGGGAGTGGGGATGG - Intronic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199322375 X:146455685-146455707 CTAGAGGAATAGAGTGGAGAGGG - Intergenic
1199808012 X:151320820-151320842 TTGGAGGCAGAGGTTGGGGTGGG - Intergenic
1199921738 X:152412769-152412791 CTGGAATCAGATAGTGGTGATGG + Intronic
1199970019 X:152852800-152852822 CTGGTGGCAGTGACTGGGTAGGG - Intronic
1199988978 X:152973670-152973692 GTGGCGGCAGAGAGCGGGGGCGG + Intergenic
1199998742 X:153045114-153045136 ATGGAGGCAGAGACTGGCTAGGG + Intergenic
1200007957 X:153100227-153100249 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1200068239 X:153515141-153515163 CTGGGGTCAGAGAATAGGGAGGG + Intergenic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200161520 X:154012281-154012303 CTGAAAGCACAGAGTGGGGCAGG + Intronic
1200167533 X:154047563-154047585 CTGAAGGAAGTGAGTGGTGAGGG + Intronic
1200181551 X:154153905-154153927 CTGGAAGCAGATAGTGGAGATGG + Intronic
1200187197 X:154191019-154191041 CTGGAAGCAGATAGTGGAGATGG + Intergenic
1200192846 X:154228157-154228179 CTGGAAGCAGATAGTGGAGATGG + Intronic
1200198601 X:154265961-154265983 CTGGAAGCAGATAGTGGAGATGG + Intronic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1201125110 Y:10905886-10905908 CTGTAGGCAGAGACTAGAGAAGG - Intergenic
1201552553 Y:15233976-15233998 CGGGAAGTAGAGAGTGGGGATGG + Intergenic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic
1202366730 Y:24170853-24170875 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1202373675 Y:24214630-24214652 TTGGAGGAAGATTGTGGGGAGGG + Intergenic
1202497106 Y:25455490-25455512 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1202504052 Y:25499270-25499292 TTGGAGGAAGATTGTGGGGAGGG + Intergenic