ID: 1037945169

View in Genome Browser
Species Human (GRCh38)
Location 8:22985114-22985136
Sequence CCCATAGGGTACCCAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037945160_1037945169 24 Left 1037945160 8:22985067-22985089 CCATGGGTGTGGCTAAGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 244
Right 1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG No data
1037945164_1037945169 -8 Left 1037945164 8:22985099-22985121 CCAGTCTCAACACCACCCATAGG 0: 1
1: 4
2: 21
3: 31
4: 140
Right 1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG No data
1037945159_1037945169 25 Left 1037945159 8:22985066-22985088 CCCATGGGTGTGGCTAAGAGGGA 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037945169 Original CRISPR CCCATAGGGTACCCAAAGTC TGG Intronic
No off target data available for this crispr