ID: 1037946493

View in Genome Browser
Species Human (GRCh38)
Location 8:22992902-22992924
Sequence GTCCCTGCTGGCAGAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037946493_1037946499 5 Left 1037946493 8:22992902-22992924 CCCACACCTCTGCCAGCAGGGAC 0: 1
1: 0
2: 2
3: 28
4: 308
Right 1037946499 8:22992930-22992952 GTAGCCTGGCCAGACCAGACTGG No data
1037946493_1037946501 11 Left 1037946493 8:22992902-22992924 CCCACACCTCTGCCAGCAGGGAC 0: 1
1: 0
2: 2
3: 28
4: 308
Right 1037946501 8:22992936-22992958 TGGCCAGACCAGACTGGAAGTGG No data
1037946493_1037946498 -9 Left 1037946493 8:22992902-22992924 CCCACACCTCTGCCAGCAGGGAC 0: 1
1: 0
2: 2
3: 28
4: 308
Right 1037946498 8:22992916-22992938 AGCAGGGACTAGGCGTAGCCTGG No data
1037946493_1037946504 21 Left 1037946493 8:22992902-22992924 CCCACACCTCTGCCAGCAGGGAC 0: 1
1: 0
2: 2
3: 28
4: 308
Right 1037946504 8:22992946-22992968 AGACTGGAAGTGGATTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037946493 Original CRISPR GTCCCTGCTGGCAGAGGTGT GGG (reversed) Intronic
900304131 1:1994935-1994957 GTCCCTGCAGACAGAGGCGCTGG + Intronic
900415431 1:2532467-2532489 TTTCCTGCTGGCGGAGGTGCTGG - Intergenic
902195430 1:14794608-14794630 GTCCCTGATGGCAGAGTCATGGG + Intronic
902436860 1:16403761-16403783 GTCCCTGCTGGTAGAGATGCTGG - Exonic
902920546 1:19664271-19664293 GTCGCTGCAGGCAGAGGCGTGGG - Intergenic
903449279 1:23441973-23441995 GTACCTGCTCCCAGAAGTGTTGG + Intronic
905166772 1:36087709-36087731 GTGCCTGGAGGCAGAGGGGTTGG - Exonic
905233645 1:36530600-36530622 TGCCCTGGTTGCAGAGGTGTGGG - Intergenic
905470506 1:38188225-38188247 GACCCTGCAGGGAGAGGTTTGGG + Intergenic
905516322 1:38564634-38564656 GTCCCAAGTGGCAGAGGTGGAGG + Intergenic
905871020 1:41404662-41404684 GTCCCTGGTGGGAGGGGTCTGGG + Intergenic
905971587 1:42145958-42145980 GTCTCTGCGTGCAGAGGTGGGGG - Intergenic
907337614 1:53710640-53710662 GCCCCAGCAGGCAGAGGGGTAGG - Intronic
907880549 1:58546275-58546297 GTCCCCTCTGGCAGAGGTGCCGG + Intronic
911336479 1:96586830-96586852 ATCTCTGCTGGCAGTGGTTTTGG - Intergenic
917080512 1:171252640-171252662 GTCCCTGCAGCCACAGCTGTGGG - Intronic
918824910 1:189312163-189312185 GCCCCTGCAGGCAGAGATCTTGG - Intergenic
919919349 1:202159184-202159206 GACCCTGCTGTCAGAGCTGGAGG + Intronic
920697172 1:208189842-208189864 GTGCCTGCTGTAGGAGGTGTGGG - Intronic
922781424 1:228256089-228256111 GTCCCTGCTGCCAAAAATGTTGG + Intronic
922843534 1:228664598-228664620 GTTCCTCCTGGCAAAGGTTTTGG - Intergenic
924713938 1:246554770-246554792 GTCCCTGGTGCCAAAGATGTTGG + Intronic
1063622244 10:7660138-7660160 GTCCTTGGTGGCAGAGATGGTGG - Intronic
1063957480 10:11280519-11280541 GTCCCTGGTGGCTGATGTCTTGG - Intronic
1064021389 10:11812107-11812129 GTCCCTGCTTTCAGTGGTTTGGG - Intergenic
1067382938 10:45791949-45791971 GTCCCTGATGGTAGGGGCGTGGG + Intronic
1067452736 10:46392321-46392343 GCCCTAGATGGCAGAGGTGTGGG - Intergenic
1067584496 10:47467434-47467456 GCCCTAGATGGCAGAGGTGTGGG + Intronic
1067890639 10:50132494-50132516 GTCCCTGATGGTAGGGGCGTGGG + Intronic
1069705485 10:70456699-70456721 CTCCCTGAGGGCAGAGGTGGGGG + Intergenic
1070827287 10:79398702-79398724 GACACTGCTGGCAGAGGTTGAGG + Intronic
1071754918 10:88526940-88526962 GTCTCTGGAGGCAGAGGTGAGGG + Intronic
1071842895 10:89491219-89491241 GGGCCTGCTGGCAGAGGGGATGG + Intronic
1072743003 10:97921593-97921615 GTCCCTAGTGTAAGAGGTGTTGG + Intronic
1073188467 10:101632153-101632175 GCCACAGCTGGCAGAGGTCTGGG + Intronic
1073263544 10:102208772-102208794 CTGCCTCCTGGCAGAGATGTAGG - Intergenic
1074348246 10:112709470-112709492 GTTCCGGCTGGCTGAGGTGCAGG - Intronic
1075444058 10:122501538-122501560 TTCCCTGCTGGCAGAGCCCTGGG + Intronic
1075649622 10:124119193-124119215 GTCCCTTCAGGCACAGGTGGTGG - Intergenic
1075778494 10:125002749-125002771 GTCCCTGCTGGCCCTTGTGTGGG - Intronic
1076131803 10:128018639-128018661 GTCCCTGGTCGCAGAGGAGATGG - Intronic
1076627723 10:131832211-131832233 ATCCCTGCTGGCATAGGGGAAGG - Intergenic
1076893610 10:133297680-133297702 GTCCCTTCTGCCAGAGCTGTGGG - Intronic
1077077161 11:706992-707014 GTCCCTGGTGGCAGGGGAGGGGG + Intronic
1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG + Intronic
1077536020 11:3124617-3124639 ATCCCTGCTGGCACAGGTCCTGG + Intronic
1078334250 11:10451149-10451171 TTCCCTGCTCGCAGAGGCGGTGG + Intronic
1079320579 11:19448233-19448255 GTCCCTGCCTGAGGAGGTGTGGG + Intronic
1080793402 11:35541038-35541060 GTCCCTGAGGGCAGAAGAGTGGG + Intergenic
1084566605 11:69932185-69932207 GGCCCTGCTGGCAGAGGCTAGGG - Intergenic
1085197763 11:74682795-74682817 GCCAGTGCTGGCAGAGGAGTAGG - Intergenic
1085198218 11:74684825-74684847 CTCCCTGTGGGCAGAGGAGTGGG + Intergenic
1087335212 11:96835538-96835560 GCTCCTGCTGGCAGTGGTGTTGG - Intergenic
1089292161 11:117443926-117443948 GCCCCGGCCGGCAGAGGTGACGG + Exonic
1089339941 11:117750470-117750492 GTACCTGCAGGCACATGTGTTGG + Intronic
1089661069 11:119985686-119985708 GTCCCTGGTGGCGGAGGAGATGG - Intergenic
1090905069 11:131067782-131067804 GGCCATGGTGGCAGAGGTGGAGG + Intergenic
1091729866 12:2872651-2872673 GTCCCTAAAGGCAGAGGTCTTGG - Intronic
1092247555 12:6872181-6872203 GTCCCTGGTGGCAGTGGTTTGGG - Intronic
1092744685 12:11662211-11662233 TGCCCTGCTGGGAGAGATGTGGG + Intronic
1095342795 12:41112051-41112073 GTCCCTGTTGCCAGAGTTATTGG + Intergenic
1095570336 12:43676438-43676460 ATTCCTGCTGACAGAGGTGCTGG + Intergenic
1095721926 12:45410147-45410169 GTCCGTGCAGGCACAGCTGTTGG + Intronic
1095757549 12:45785963-45785985 TTCCCTGCTGTCAGAAATGTTGG + Intronic
1095968095 12:47882930-47882952 GTCATCGCTGGCAGGGGTGTGGG + Intronic
1097111045 12:56658395-56658417 GACCCGGCAGGCAGAGGTTTTGG - Intergenic
1097133454 12:56831452-56831474 CTTCCTGCTGACAGAGGGGTGGG + Intergenic
1099661535 12:85568978-85569000 GGCCCTGCTTTCAGAGGTGGTGG - Intergenic
1101675877 12:106915718-106915740 GTCCCAGCAGACAGAGGAGTAGG - Intergenic
1103560636 12:121791760-121791782 GGCCCTGATGGCAGAGGAGGAGG + Intronic
1104133362 12:125915726-125915748 GACCTTTCAGGCAGAGGTGTAGG + Intergenic
1104848156 12:131857571-131857593 GGCCCTGCAGCCAGTGGTGTTGG + Intergenic
1104969871 12:132526487-132526509 CTCCCAGCTGCCAGAGGGGTGGG - Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107893660 13:44937001-44937023 GTCCCTGCTGCCAAAGAGGTTGG + Intergenic
1110597905 13:77339225-77339247 TTCCCAGCTGTCAGAAGTGTTGG + Intergenic
1113377881 13:109782082-109782104 GTCAATGCTGGCGTAGGTGTTGG + Exonic
1113749634 13:112768248-112768270 GACGCTGCTGGTAGAGGTGGAGG - Intronic
1116782465 14:49251138-49251160 ATTCATGCTGGCAGAGGTGTGGG - Intergenic
1117164084 14:53016604-53016626 GACCCTGCAGGCAGAGATCTAGG - Intergenic
1117747120 14:58881143-58881165 GTCCCTCCAGTAAGAGGTGTGGG + Intergenic
1118102572 14:62623338-62623360 GTCTCTGCAGGCAGAGTTGTTGG - Intergenic
1118626014 14:67659907-67659929 TTCCCAGCTGGCAGAGATGGAGG - Exonic
1119483547 14:74974484-74974506 CTCCCAGCTGGGAGCGGTGTGGG + Intergenic
1120200551 14:81533783-81533805 GTCCGTGGTGGCAGAGGCGAAGG - Exonic
1120840233 14:89078929-89078951 GCCCCTTCTGGCTGTGGTGTGGG - Intergenic
1121868754 14:97387616-97387638 GCTCCTGCTGGCACAGGAGTGGG - Intergenic
1122943071 14:104991704-104991726 GTGGGTGCAGGCAGAGGTGTGGG + Intronic
1123835428 15:24186192-24186214 GTCCCTGCTTCCAGAGGCCTGGG + Intergenic
1123850194 15:24347553-24347575 GTCCCTGCTTCCAGAGGCCTGGG + Intergenic
1123871163 15:24575049-24575071 GTCCCTGCTTCCAGAGGCCTGGG + Intergenic
1124019813 15:25909886-25909908 GTCCCTGCTGGGAAAGGAGACGG - Intergenic
1124390211 15:29248747-29248769 TTCAGTGCTGGCAAAGGTGTAGG + Intronic
1126097862 15:45101931-45101953 GGCCCAGCTGGCCGAGGTGGTGG - Exonic
1126106170 15:45148308-45148330 GGCCCAGCTGGCTGAGGTGGTGG + Exonic
1126305021 15:47246165-47246187 GTGACTACTAGCAGAGGTGTTGG + Intronic
1126901703 15:53321168-53321190 GTCACAGCTGGCAGAGAGGTTGG + Intergenic
1127426708 15:58865281-58865303 GGCCCTGCTGGAAGAGTTCTGGG + Intronic
1128565442 15:68697944-68697966 GTCCCTGCCTGCTGAGGTGCTGG + Intronic
1129199988 15:73992958-73992980 GTCCCTGCTTGCTGGGCTGTGGG - Intronic
1129461499 15:75702181-75702203 GACCCTGCAGGCAGAGTTGAGGG - Intronic
1131089994 15:89616833-89616855 GCCTTTGCTGACAGAGGTGTGGG + Intronic
1131273451 15:90960753-90960775 GTCCCTGCTGTCAGAGGCGGCGG - Intronic
1132343241 15:101091203-101091225 GTCCGTGCTGGCTGAGCTCTGGG + Intergenic
1132691316 16:1183071-1183093 GTCCCTGCTGCTGGGGGTGTCGG - Intronic
1132693847 16:1193438-1193460 GTCCTTGCTGGACGAGGTGGGGG - Intronic
1132757181 16:1491375-1491397 GTCTCTGCAGGCAGAGCTGATGG - Intergenic
1132813941 16:1817134-1817156 CTCCCTGCGGGCCGGGGTGTGGG - Intronic
1133284386 16:4683824-4683846 GTCCCTGCAGGCAGAGGGTGAGG - Exonic
1133439282 16:5807016-5807038 GTGCCTGCTGGAGGAGGTGTCGG - Intergenic
1134442390 16:14307069-14307091 GCCTCGGCTGGCAGAGGTCTGGG - Intergenic
1136570404 16:31093415-31093437 GCCCCACCTGGCAGAGGGGTGGG + Exonic
1137436156 16:48455689-48455711 CTCCCAGTTGGCAGAGGTGCAGG + Intergenic
1137666054 16:50249749-50249771 GGCCCTGCTGGGGGAGGTGGTGG + Intronic
1138286107 16:55811529-55811551 GTCCCTGAGTGCAGAGGTTTGGG - Intronic
1141105407 16:81229346-81229368 GCCCCTCCTGGCATTGGTGTCGG - Intergenic
1141525936 16:84611933-84611955 GGCTCAGCTGGCAGAGGTGGAGG - Intronic
1141907963 16:87040264-87040286 GGCCCTGCTGGCTGAGTTGCAGG - Intergenic
1142105921 16:88302729-88302751 GTCCCTGCTGGCTGCTCTGTAGG + Intergenic
1142433414 16:90042743-90042765 GTCTCTGCTGGGATGGGTGTAGG + Intronic
1142482581 17:227996-228018 GTCCCTGCTGGGACAGGGGACGG + Intronic
1142747961 17:1969622-1969644 GTCCAGGCAGGCAGAGGAGTGGG - Intronic
1143041805 17:4043666-4043688 GTCCCTCTTGGCAGGTGTGTAGG - Intronic
1143742256 17:8963368-8963390 GGGCCTGCTGGCTGAGGAGTGGG - Intronic
1143803386 17:9404233-9404255 GTCTCAGGTGGCAGAGGTGGAGG + Intronic
1143868937 17:9944183-9944205 GGCCGTGCGGGCAGATGTGTGGG - Intronic
1144514720 17:15909498-15909520 GACTATGGTGGCAGAGGTGTGGG - Intergenic
1145127589 17:20314935-20314957 GACTTTGGTGGCAGAGGTGTGGG - Intronic
1145237515 17:21219216-21219238 GACCATGCTGGCACAGCTGTGGG - Intergenic
1145290632 17:21542772-21542794 CTCCCTCCTGGCAGAGAAGTGGG + Intronic
1145905741 17:28515186-28515208 GTCCCTGCTGACAGCTCTGTGGG + Intronic
1146059169 17:29595584-29595606 GCCGCTGCAGGTAGAGGTGTTGG + Intronic
1149181982 17:53950669-53950691 GGCCCTGCTGCCAGGGGTGGTGG - Intergenic
1149566036 17:57641321-57641343 GTCCTGGTTGGCAGAGGTGAGGG + Intronic
1150330724 17:64292299-64292321 GTCCCTGGTGGGAGAGGGGGGGG + Intergenic
1151732605 17:75920279-75920301 GGCCCGGCTGGCAGAGCTGGAGG - Exonic
1151740712 17:75979807-75979829 GTCTTTACTGGCAGAGGCGTGGG + Intronic
1152363173 17:79841699-79841721 CTCCCTGCTGCCAGGGGCGTCGG + Intergenic
1152610583 17:81313308-81313330 GTCGCTCCTGGCAGAGGTGGGGG + Exonic
1152740762 17:82017363-82017385 ATTCCTGCTGGCAGAGGAGGTGG - Exonic
1156033913 18:32744919-32744941 GTCACTGTTGGCAGGGGTGGAGG - Intronic
1156494012 18:37513984-37514006 ATACCTTCTGACAGAGGTGTGGG + Intronic
1157200141 18:45653094-45653116 GTCCCTGCTGGCTGGTCTGTTGG - Intronic
1157282830 18:46357489-46357511 GGCTGTGCTGGCAGAGGTGGAGG + Intronic
1157591850 18:48841011-48841033 GTGCTTGGTGGCAGAGGAGTGGG + Intronic
1157664030 18:49470196-49470218 GTCACTGCTGGAAGAGGAGGAGG - Intergenic
1158263507 18:55635061-55635083 GTACATGCTGGCAGAGTTCTTGG + Intronic
1159895243 18:73989865-73989887 GGCCCACCTGGCAGAGGTGAAGG - Intergenic
1160014036 18:75127373-75127395 CTCCCTCCTGGCACAGGTCTCGG - Intergenic
1160898638 19:1415537-1415559 GGCCCTGCTGGCAGGGATGTGGG + Intronic
1161034517 19:2077010-2077032 GTGCCTGCAGGGAGAGGGGTGGG + Exonic
1161128636 19:2574707-2574729 GTCCCTGCTGTCAGTTCTGTGGG + Intronic
1161644422 19:5444415-5444437 GACTCTGCAGGCAGAGGTGTTGG - Intergenic
1163320865 19:16573785-16573807 GTCCCTGCAGGCAGGGGTAGTGG + Intronic
1163829536 19:19541121-19541143 GTCCCTGCTCGGGGAGCTGTGGG + Exonic
1164782832 19:30907094-30907116 CTGCCTGCTGGCACAGGTGCCGG - Intergenic
1164929779 19:32166509-32166531 GTCCCTGCTGGCAGAGTTCCAGG + Intergenic
1165433877 19:35786651-35786673 GTCCCTCCAGGCAGCGGGGTGGG - Intronic
1165828436 19:38718814-38718836 GTCCACGCTCACAGAGGTGTGGG - Intronic
1166367900 19:42286491-42286513 GTCCCTGGTGGCAGGGCTGGTGG + Intronic
1167533057 19:50031007-50031029 TTCCCGGCTGGCAGGGCTGTGGG - Exonic
1168019451 19:53598399-53598421 GTCCCTGCCTGCAGAGCAGTTGG - Intergenic
1168323878 19:55528144-55528166 GGTCCTGATGGCAGAGCTGTGGG - Intergenic
1168643096 19:58042840-58042862 GGCCCTGGTGGGAGAGGGGTGGG - Intronic
925015740 2:522933-522955 TCCCCTGATGGCAGAGGTGCAGG - Intergenic
925068163 2:945956-945978 GTCCTTGCTTGCAGAGGAGTTGG - Intergenic
925188417 2:1864863-1864885 GTGGCTGCTGCCAGAGGGGTTGG + Intronic
925410493 2:3637119-3637141 GTCCATGCTTACAGAGTTGTGGG + Intronic
926104417 2:10141501-10141523 GTCACTGCCAGCAGAGGTCTGGG + Exonic
927499593 2:23573892-23573914 GCCCCCGCTTTCAGAGGTGTTGG + Intronic
927554719 2:24023583-24023605 GTCCATGCTGCCAGACGTGGTGG + Exonic
927947914 2:27148548-27148570 GTACCTCCTGGCAGAGCTGGAGG + Intergenic
928200958 2:29247253-29247275 GGCCCTGCTGCCAGTGGTGGTGG - Intronic
928638642 2:33274987-33275009 GGCCCTGGGAGCAGAGGTGTTGG - Exonic
928964891 2:36966558-36966580 CTCCCTGCTGACTGGGGTGTGGG - Intergenic
930033750 2:47073140-47073162 CTCCCTGGTGGCAGTGGTGAAGG + Intronic
930058446 2:47269812-47269834 GTCCCTGCTGGAAATGGTCTTGG - Intergenic
930716710 2:54600168-54600190 TTGCCTGCGGTCAGAGGTGTGGG - Intronic
934876061 2:97922022-97922044 GTCCCTGGTGCCAGAAATGTTGG - Intronic
937096804 2:119240864-119240886 GTCCCTGCGGCCTGAGGTGAGGG - Intronic
939175331 2:138741278-138741300 GCGACTGCTGGCAGAGCTGTGGG + Intronic
941658252 2:168167681-168167703 CTCTCTGCTGGCAGAGTTGGGGG - Intronic
942428392 2:175883674-175883696 GCCCTTGCTAGCACAGGTGTAGG + Intergenic
945979475 2:216297417-216297439 ATCCCTGAGTGCAGAGGTGTGGG - Intronic
946269356 2:218577586-218577608 GGCCCTGCTGGCAGTGGTGTAGG - Intronic
947835152 2:233169938-233169960 GTCACTCCTGCCATAGGTGTGGG - Intronic
948380916 2:237549497-237549519 GGCCCTGGTGGCAGCGGTGGTGG + Intronic
948858699 2:240742706-240742728 GGAGCTGGTGGCAGAGGTGTGGG - Intronic
1168996780 20:2139118-2139140 GTGCCTGCAGGCTGAGGAGTAGG + Intronic
1169269354 20:4187380-4187402 TCCCCTGCTGGAAGAGGTCTCGG - Exonic
1170568953 20:17622220-17622242 GTCCCTGCTGGGAGATGTCCCGG - Intronic
1171173815 20:23036569-23036591 CTTCCTGCTGGCAGGGGAGTGGG - Exonic
1171209013 20:23302651-23302673 CTCCCTGCTGACAGGGTTGTAGG + Intergenic
1171217549 20:23362862-23362884 GGCCCTGTTGGCAGAGGTCTGGG + Intronic
1172446101 20:34994272-34994294 GGCCCTGCGGGCAGAGCTGCGGG + Exonic
1172449659 20:35012971-35012993 GTCCCTGCAAGGAGAGTTGTTGG - Intronic
1174036568 20:47672244-47672266 GTCCCCGCTGTCACAGGTGCAGG + Exonic
1174180065 20:48668960-48668982 GTCCCTGCTGGCCTAGCTTTAGG - Intronic
1175585111 20:60132973-60132995 GTGCCTGTTGGCAGAGGTAGGGG + Intergenic
1175782453 20:61691110-61691132 GTCCCTGCTGGCCGAGGGGTGGG - Intronic
1175982566 20:62746443-62746465 GCCCCTGCCGTCAGAGGTCTTGG - Intronic
1176037392 20:63046470-63046492 GGCCCTGCTGGGAGAGGTTTTGG + Intergenic
1176095940 20:63344656-63344678 GACCCAGCTGCCAGATGTGTGGG - Exonic
1176120608 20:63452948-63452970 GTCCCTGCAGGCTGAGGGGAGGG + Intronic
1176152200 20:63597564-63597586 GTCCCTGTTGGCAGGAGTGTGGG + Intronic
1177043842 21:16145749-16145771 GTGCCTGCAGGCACAGGTCTAGG + Intergenic
1181462450 22:23093850-23093872 GTCTCTCCTGGCAGTGGTGGTGG - Intronic
1181562593 22:23714545-23714567 GTCCCTGGTGGCAGGGTTGGGGG + Intergenic
1181685281 22:24523731-24523753 TCACCTGCTGGCAGAGGTTTAGG - Exonic
1182145224 22:27993275-27993297 GTCCCTGCTGGGTGAGCTGTGGG - Exonic
1183324292 22:37183103-37183125 GTCCAGGCTGGCAGGGATGTGGG + Intronic
1183668305 22:39257530-39257552 GGCCCTGCTGGCAGAGGGAAGGG - Intergenic
1184359234 22:44004223-44004245 CCCCCTGCTGGCAGAGGTGCTGG + Intronic
1184462217 22:44645709-44645731 GTCCCTGCTGGCCGTGTGGTGGG + Intergenic
1184768892 22:46586700-46586722 GTCCCTGCTGGGACATGAGTTGG + Intronic
1185344052 22:50303792-50303814 GACCCTGCTGGCAGAGCTGGTGG + Intronic
949920096 3:8993582-8993604 GTCCCTGATCTCAGAGGTCTGGG + Intronic
950561920 3:13735839-13735861 GTCCCTGCTGGGAGACATGGGGG + Intergenic
950911989 3:16604873-16604895 TTCTCTACTGGCAGAGGTTTGGG - Intronic
953391694 3:42537500-42537522 GGATCTTCTGGCAGAGGTGTGGG - Exonic
955364536 3:58299826-58299848 GTAGCTGCTGGCAGAGGGGTGGG + Intergenic
956026956 3:64993191-64993213 GTGCCTGCTGTCAGAAGTGCTGG - Intergenic
956030640 3:65033625-65033647 TTCCCTGCCAGGAGAGGTGTTGG - Intergenic
956373624 3:68590540-68590562 GTCGCTGCAGCCAGAGGGGTGGG + Intergenic
957881148 3:86214419-86214441 GTCCAAGATGGCAGAGATGTGGG - Intergenic
958936491 3:100261204-100261226 CACCCAGCTGGCAGAGGGGTAGG - Intronic
959162130 3:102736316-102736338 GTCCCTGCTGGACGCGGTGCAGG + Intergenic
960235973 3:115282629-115282651 GTCCCTCCTGCCACTGGTGTGGG + Intergenic
960274218 3:115708762-115708784 CCCCCAGCTGCCAGAGGTGTTGG - Intronic
960875691 3:122292992-122293014 GAACCTGCTGGCAGAGGAGATGG + Intergenic
961682510 3:128608478-128608500 CTCCCGGCTGGCAGAGGGGCCGG - Intergenic
963390646 3:144659535-144659557 GTCCCTGCTGTAAGAGATTTGGG - Intergenic
964569245 3:158094621-158094643 GGCCCTGCTGGCGGAGGCGCCGG - Intergenic
966313892 3:178624801-178624823 GTCCCGAGTGACAGAGGTGTGGG + Intronic
966556839 3:181271774-181271796 GTCCCTGCTGCCAAAAGGGTTGG + Intergenic
966939100 3:184734202-184734224 ATCCCTGCTGTGAGAGGTCTGGG + Intergenic
967315299 3:188146933-188146955 GTCTCTTGTGGCAGAGATGTTGG - Intergenic
968313745 3:197705050-197705072 GGCTGTGCTGGCAGAGCTGTGGG - Intronic
968503628 4:962143-962165 CTGCCTGCCGGCAGAGCTGTTGG - Intronic
968659750 4:1794078-1794100 GCCCGTGCGGGCAGAGGCGTTGG + Intronic
968871311 4:3244103-3244125 GTCCCTGCTGGCAGCTGCCTGGG - Intergenic
969455066 4:7295815-7295837 ATCCCAGGTGGGAGAGGTGTGGG - Intronic
969534975 4:7750771-7750793 GCCCCTTCTGGCAAAGTTGTTGG + Intergenic
970446586 4:16128014-16128036 GTGCATGCTGGAAGAAGTGTGGG - Intergenic
971079858 4:23197111-23197133 ATCCCCGCTGGGAGATGTGTGGG + Intergenic
971359395 4:25922809-25922831 ATCCATGCTGGCACAGGTGAAGG - Intronic
979529929 4:121759364-121759386 GAACCAGCTGGGAGAGGTGTGGG - Exonic
981529192 4:145735467-145735489 GTCTCTCCTAGCAGAGGTGGTGG + Intronic
982747367 4:159118533-159118555 GTCCCTGGTGCCAGAAGGGTTGG + Intronic
985905366 5:2830965-2830987 GTCCCTGCTCCCAGAGCTGAGGG + Intergenic
987045970 5:14108627-14108649 GTCCCTGCTGACCAAGGTGGCGG - Intergenic
987114302 5:14714090-14714112 CTGCCTGCGGTCAGAGGTGTGGG + Intronic
988880138 5:35493582-35493604 GTCTCTGATGGAAGAGGTGGAGG + Intergenic
996948428 5:129096405-129096427 GACACTTCTGGCACAGGTGTTGG - Intronic
997048933 5:130355801-130355823 GTCTCTGCTGACTGAGGTCTGGG - Intergenic
998370310 5:141656477-141656499 GGCCCTGGGGCCAGAGGTGTGGG - Intronic
998613425 5:143713881-143713903 GTCCATGGTGTCAGAGGTGATGG - Intergenic
1000866664 5:166522748-166522770 GTCTCTGCAGGTAGAGGTGTGGG - Intergenic
1001298643 5:170517430-170517452 GTTGATGATGGCAGAGGTGTTGG + Intronic
1001334093 5:170783496-170783518 GTCTTTTCTGGCAGAGGTCTGGG + Intronic
1002560522 5:180078942-180078964 GTCCCTGGTGTCAAAAGTGTTGG + Intergenic
1003326277 6:5093739-5093761 TTACGTGCTGGCAGAGGTTTGGG + Intergenic
1004517976 6:16336777-16336799 GTCCCAGCTGGCAGTGGTAGTGG - Intronic
1005260182 6:24050562-24050584 GTCCCTGGTGCCAAAGATGTTGG + Intergenic
1006358445 6:33574126-33574148 GGCCATGCTGGTAGACGTGTAGG + Exonic
1007070341 6:39032682-39032704 GTCTCTGGTGGCAGAGATGGTGG - Intergenic
1007118528 6:39361711-39361733 GTCGCTCCTGGCAGATGTGCAGG - Intronic
1008381890 6:50846040-50846062 TTCCGTACTGGCAGAGGTGGAGG - Exonic
1009332866 6:62445671-62445693 GTCCATACTGGCAGCAGTGTCGG + Intergenic
1011571786 6:88745958-88745980 GTACCTGCTGGCAAAGGAGCAGG - Intronic
1013072053 6:106738209-106738231 GCCAATGCTGGCAGAGGTGTGGG - Intergenic
1015803106 6:137080555-137080577 TTCCCAGCAGCCAGAGGTGTTGG - Intergenic
1017676503 6:156819930-156819952 TTTCCTGCTGGCAGAGATGGGGG + Intronic
1017722420 6:157253201-157253223 GTCCCAGCTGGCATAGGTGCAGG - Intergenic
1017889132 6:158624844-158624866 GTCCCTGGTGGGAGGGGTTTGGG + Intronic
1018752803 6:166822022-166822044 GTCCATGGTGACAGAGGTGGAGG - Intronic
1018901524 6:168054136-168054158 CTCCCTGCTGGGTGGGGTGTGGG - Intergenic
1019143813 6:169964010-169964032 GTTCCTCCGGGCACAGGTGTGGG + Intergenic
1019624523 7:2009248-2009270 GTCCTGGCTGGCAGGAGTGTTGG - Intronic
1021503460 7:21354917-21354939 GCACCTGATGGCAGATGTGTAGG - Intergenic
1021612584 7:22472729-22472751 GTTTCTGCTGGGAGAGGGGTAGG - Intronic
1021783550 7:24130267-24130289 GCCCATGGTGGGAGAGGTGTGGG - Intergenic
1023125938 7:36954352-36954374 GTCCCTTGAGGCAGGGGTGTGGG + Intronic
1023921111 7:44630771-44630793 GTCCCTGGTGCCAAAGGAGTTGG - Intronic
1024249491 7:47495544-47495566 GTTCAGGCTGGGAGAGGTGTTGG - Intronic
1025928866 7:65979754-65979776 GTCCCTGGTGGCAGGGTGGTGGG + Exonic
1026551642 7:71373806-71373828 GTCCCTGCTGCCAAAAATGTTGG + Intronic
1026572416 7:71542895-71542917 ATCCCACCTGGCAGATGTGTTGG + Intronic
1026589265 7:71681336-71681358 GTCCCTGCTGGAACTGCTGTAGG - Intronic
1026647811 7:72187648-72187670 GTCCCTGCTGCCAAAAGGGTTGG + Intronic
1032195956 7:129788704-129788726 GTCTCTGCTGGCAGGGGAGCAGG - Intergenic
1032470366 7:132174276-132174298 GTCCCTGCTGGTAGAAGAGAGGG + Intronic
1033283662 7:140023008-140023030 GGCCCTGTTGGCAGAGGGGCTGG - Intergenic
1035015694 7:155763932-155763954 GGCCCCGCTGGCAGATGTGGGGG - Exonic
1035043955 7:155952042-155952064 GCCTCTCCTGGCAGAGCTGTGGG - Intergenic
1037177289 8:15962150-15962172 GTGCCTCCTGGGAAAGGTGTGGG - Intergenic
1037946493 8:22992902-22992924 GTCCCTGCTGGCAGAGGTGTGGG - Intronic
1037953950 8:23038827-23038849 GTCCCTGGTGGCAAAAATGTTGG - Intronic
1038745111 8:30248161-30248183 GTCCCTGCAGCCACAGCTGTGGG + Intergenic
1039533502 8:38286377-38286399 TTCCCTGCTTGCACAGTTGTTGG - Intronic
1039550978 8:38442653-38442675 GCCCCAGCTGGGAGAGGTGGGGG - Intronic
1040385973 8:46915402-46915424 GACCCTGGTGGGAGAGCTGTGGG + Intergenic
1040701234 8:50068525-50068547 GTCCTGGCTGGCAGGGGTGGGGG - Intronic
1042566691 8:70118484-70118506 GTCCCGAGTGGCAGAGGTGCTGG - Intronic
1042764776 8:72308965-72308987 GTCCATGCTGGCAAAGCAGTGGG + Intergenic
1044413368 8:91909742-91909764 GTCACTGCTGGAAGAGGAGGAGG + Intergenic
1045498394 8:102727195-102727217 GTGAGTGCTGGCAGAGGTGAGGG + Intergenic
1048831172 8:138478827-138478849 ATCTCTGCCGGCAGATGTGTTGG + Intronic
1048927495 8:139284075-139284097 GCGCCTGCTTGCAGAGGTGCAGG - Intergenic
1049418131 8:142504811-142504833 GTCTCTGCAGGCAGAGGCTTCGG - Intronic
1049815801 8:144599053-144599075 CTGCCTGCTGTCAGATGTGTGGG - Intronic
1050242993 9:3658265-3658287 GTGGGTGCTGGCAGTGGTGTTGG + Intergenic
1051800879 9:20932387-20932409 GTCCCTCCAGGCAGATTTGTGGG - Intronic
1052565572 9:30145568-30145590 GTCCCTGGTGTCAAAAGTGTTGG + Intergenic
1055558872 9:77502791-77502813 GTCTTTGCTGGCATGGGTGTGGG + Intronic
1057295137 9:93830327-93830349 GTCCCAGCCAGGAGAGGTGTGGG + Intergenic
1057923602 9:99121615-99121637 ATCACTGCTGGCAAAGGTGAAGG - Intronic
1057948533 9:99351303-99351325 GTCCCAGCTGTAAGAGCTGTAGG - Intergenic
1058393134 9:104520185-104520207 GGCCCTGGTGGCACAGGTATTGG - Intergenic
1058678162 9:107418956-107418978 ATCCCTGTTGGCAATGGTGTGGG - Intergenic
1059982002 9:119783588-119783610 GTACCTAGTGGCTGAGGTGTTGG - Intergenic
1060228232 9:121809040-121809062 GATCCTGATGGCAGAGGTGTTGG + Intergenic
1061028152 9:128063813-128063835 GTCTCTGGTGGCAGAGGTGGGGG + Exonic
1061286951 9:129629211-129629233 GTACCTGCTGGCAGAGGGGCAGG + Intronic
1061402860 9:130377957-130377979 GTCCCTCAAGGCAGAGGGGTTGG - Intronic
1061607264 9:131720415-131720437 GACACTGCTGGTAGAGGTGGGGG - Intronic
1062263285 9:135674170-135674192 GTCGCTGCTGGCAAGGATGTGGG + Intergenic
1062666107 9:137673495-137673517 GTCCCTGGTGGCTGAGCTGAAGG + Intronic
1203492275 Un_GL000224v1:118735-118757 GTCCCTGCTCCCAGATGAGTGGG + Intergenic
1203504898 Un_KI270741v1:60607-60629 GTCCCTGCTCCCAGATGAGTGGG + Intergenic
1188483264 X:30655365-30655387 GTCCCTGCAGGCATTTGTGTGGG - Intronic
1189279515 X:39811354-39811376 GTTCCTTCTGGCAAAGATGTGGG + Intergenic
1190228077 X:48560915-48560937 TTACCTGCAGTCAGAGGTGTGGG + Exonic
1190887042 X:54539479-54539501 GGTCCTGCTGGGAAAGGTGTGGG + Intronic
1192234021 X:69284910-69284932 GTCAGTGCTGGAAGAGGTCTGGG - Intergenic
1198109097 X:133487086-133487108 ATCCCTACTGGCAAAGGTGCTGG + Intergenic
1198505479 X:137296996-137297018 ATCTAGGCTGGCAGAGGTGTTGG - Intergenic
1200960324 Y:8990595-8990617 TTCCTTGTTGGCAGATGTGTGGG - Intergenic
1201332419 Y:12838994-12839016 GTCCCAACTGTCAGAAGTGTGGG - Intronic