ID: 1037948763

View in Genome Browser
Species Human (GRCh38)
Location 8:23005422-23005444
Sequence GGTCTCCAAAGGTGTCCCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037948763_1037948767 5 Left 1037948763 8:23005422-23005444 CCTCTGGGACACCTTTGGAGACC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1037948767 8:23005450-23005472 AAAGACCGTCGCTTTGCTTATGG 0: 1
1: 0
2: 0
3: 3
4: 41
1037948763_1037948773 18 Left 1037948763 8:23005422-23005444 CCTCTGGGACACCTTTGGAGACC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1037948773 8:23005463-23005485 TTGCTTATGGGAGGTAGGGAAGG 0: 1
1: 0
2: 0
3: 34
4: 302
1037948763_1037948769 9 Left 1037948763 8:23005422-23005444 CCTCTGGGACACCTTTGGAGACC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1037948769 8:23005454-23005476 ACCGTCGCTTTGCTTATGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 18
1037948763_1037948768 6 Left 1037948763 8:23005422-23005444 CCTCTGGGACACCTTTGGAGACC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1037948768 8:23005451-23005473 AAGACCGTCGCTTTGCTTATGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1037948763_1037948772 14 Left 1037948763 8:23005422-23005444 CCTCTGGGACACCTTTGGAGACC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1037948772 8:23005459-23005481 CGCTTTGCTTATGGGAGGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1037948763_1037948771 13 Left 1037948763 8:23005422-23005444 CCTCTGGGACACCTTTGGAGACC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1037948771 8:23005458-23005480 TCGCTTTGCTTATGGGAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037948763 Original CRISPR GGTCTCCAAAGGTGTCCCAG AGG (reversed) Exonic
901169381 1:7245718-7245740 GGTCTCGGAAGGTTTCCCTGTGG + Intronic
902398120 1:16143432-16143454 GCTCTCCACAGGTGTGCCACAGG - Intronic
903342086 1:22660909-22660931 GGGCCCTAAAGGTGGCCCAGGGG + Exonic
904080309 1:27868404-27868426 GATCTCCACAGTTGTCTCAGAGG + Intergenic
904261612 1:29290932-29290954 GGTCTCCAGGGGTGTGCCACAGG - Intronic
905798268 1:40827591-40827613 GGTTTCCAAAGGTGCCTCTGGGG + Intronic
906137162 1:43507618-43507640 GGTGTGCAAAAGTGACCCAGGGG + Intergenic
909596567 1:77412885-77412907 GGACTCCCAAGGTGCCCCCGTGG - Intronic
913182029 1:116331373-116331395 GGTCTTGCAAGATGTCCCAGAGG - Intergenic
915080849 1:153350841-153350863 GTTCTCAAAAAGTGGCCCAGGGG + Intergenic
915525219 1:156471933-156471955 GGGCTCCAAGGGCGGCCCAGGGG + Intronic
916787143 1:168094738-168094760 GTTCTCCAAATCTCTCCCAGTGG + Intronic
916980837 1:170135323-170135345 GGCTTCCAAAGGTTTCCAAGAGG + Intergenic
918580373 1:186120048-186120070 GATCTCCAGAGCTGTCCGAGAGG + Exonic
924797690 1:247304176-247304198 TGACTCCAAAGGTGGCTCAGAGG + Intronic
1064347223 10:14543381-14543403 GGTCTCCAAAGGCTTCAGAGTGG - Intronic
1064875206 10:19986032-19986054 GCTTTCCAAAGGCTTCCCAGTGG - Intronic
1064910917 10:20401011-20401033 GGTCTCCAAGGATTCCCCAGAGG + Intergenic
1065832617 10:29629021-29629043 GGTCTTGAAAGGTGTCCAAGAGG + Intronic
1066583280 10:36903720-36903742 GGCTTCAAAAGGTGTTCCAGGGG + Intergenic
1068050173 10:51940492-51940514 GGTATCCAAACTTGTACCAGTGG - Intronic
1068283841 10:54909906-54909928 GGTCTCCAGGGGGGTCTCAGGGG + Intronic
1072031305 10:91525115-91525137 GGACTCCAACGGTGCCCTAGGGG - Intergenic
1073077106 10:100830990-100831012 GGGCTGGGAAGGTGTCCCAGGGG - Intergenic
1074997478 10:118770377-118770399 GGTGTCCACAGATGGCCCAGAGG + Intergenic
1076169437 10:128307338-128307360 GGTCTCTACAGGACTCCCAGAGG + Intergenic
1076584356 10:131535106-131535128 CATGTCCAAAGGGGTCCCAGTGG - Intergenic
1076715898 10:132363544-132363566 GGTCTCCAGTGGTCTCCCTGAGG - Intronic
1079756477 11:24270935-24270957 GGTATCCACAGCTGTACCAGTGG - Intergenic
1083459367 11:62800393-62800415 GGTCTCGGAAGGTGTCACACAGG + Exonic
1084708948 11:70832049-70832071 TGTCCCCAAAGGTGTCCCCACGG - Intronic
1085567313 11:77525963-77525985 CCTCTCCAAAGAGGTCCCAGCGG - Intronic
1088605925 11:111532064-111532086 GGACTCAGAAGATGTCCCAGGGG - Intronic
1088731811 11:112690159-112690181 GCTCTCAGTAGGTGTCCCAGGGG + Intergenic
1091011968 11:132009585-132009607 GGGCTCCAAAGACGTCCCTGGGG - Intronic
1099908127 12:88796166-88796188 TGTCTCCTCAGATGTCCCAGAGG - Intergenic
1101953660 12:109195445-109195467 GGTCCCCAAAGGTAGCCAAGAGG - Intronic
1115317576 14:32041171-32041193 GGTATCCAAGAGTCTCCCAGAGG + Intergenic
1119559848 14:75581295-75581317 AGTGTCCAAAGGGGTCCAAGGGG + Intronic
1120700068 14:87689700-87689722 GGTGTACACAGGTCTCCCAGTGG - Intergenic
1121035048 14:90696231-90696253 TGTCACCAAATGTGTCCCTGTGG - Intronic
1121562813 14:94887272-94887294 AGTCCCCAGAGGAGTCCCAGGGG - Intergenic
1127298343 15:57629522-57629544 GGTCTCCCATGGTGGCCAAGAGG - Intronic
1132382903 15:101379022-101379044 TGTCTCCAACGCTGCCCCAGTGG - Intronic
1132606955 16:797566-797588 GGTTCCGAAAGGTGTCTCAGAGG + Intronic
1132669680 16:1097475-1097497 GCTCTGCAGATGTGTCCCAGTGG + Intergenic
1132995640 16:2821043-2821065 TGTCTCCAAAGATGTCCTTGCGG - Exonic
1133905127 16:10015415-10015437 GGTCTCCAAAGGTAGGCCACAGG - Intronic
1134415893 16:14043052-14043074 AGTCTCCAGAAGTCTCCCAGAGG - Intergenic
1135709108 16:24700092-24700114 GGGATCAAAAGGTGCCCCAGAGG + Intergenic
1136232955 16:28898223-28898245 GGTCTCCTAGGGTGCCCCTGAGG + Exonic
1136933950 16:34441771-34441793 GTTCTCCAGTGTTGTCCCAGGGG - Intergenic
1136970622 16:34970043-34970065 GTTCTCCAGTGTTGTCCCAGGGG + Intergenic
1137803868 16:51285763-51285785 GGTCTCCCAGGGTTCCCCAGTGG - Intergenic
1139275100 16:65720044-65720066 GGTCTCTAAAGGTGATCAAGTGG - Intergenic
1140895820 16:79323299-79323321 TGTCACGAATGGTGTCCCAGGGG + Intergenic
1140906974 16:79417448-79417470 GGTTTCCAAGGGTGACCCAAAGG + Intergenic
1141372199 16:83498328-83498350 AGGCTCCAAAGGAGTCCCTGAGG + Intronic
1142114349 16:88348583-88348605 GGGGTCCAACAGTGTCCCAGTGG + Intergenic
1144574457 17:16420160-16420182 GGTCTCCCGGGGTGTCCCCGAGG + Exonic
1152034812 17:77865554-77865576 GCGCTCCAAAGCTGTCCCCGGGG - Intergenic
1152810981 17:82382822-82382844 GGCCTCCAGGGGTGGCCCAGGGG - Intergenic
1155423735 18:25684515-25684537 GGTCACCAAAGGTGGCCAAAAGG + Intergenic
1157611329 18:48958059-48958081 GGCCTCAAAAGGTTTCCCAAAGG + Intergenic
1158423760 18:57320556-57320578 GCTCTCCAACCTTGTCCCAGGGG + Intergenic
1160161838 18:76479463-76479485 ATTGTCCAAAGGTGTCCCTGGGG + Intronic
1165789921 19:38485234-38485256 GGACCCCAGAGGTATCCCAGGGG + Intronic
1167693932 19:51003079-51003101 GGTCTTCCAAGGTGCCCCCGTGG + Exonic
927844306 2:26463503-26463525 GATGTCCAGAGGCGTCCCAGGGG + Exonic
931461081 2:62450629-62450651 AGTCTCCCAGGGTGTCCCAAAGG - Intergenic
938716746 2:134028166-134028188 GGCGTCCAGTGGTGTCCCAGGGG + Intergenic
938948344 2:136234846-136234868 GGTCTCCAATGGTGGCGAAGAGG + Intergenic
945653200 2:212590608-212590630 GGTCTCCCAAAGTGCTCCAGAGG - Intergenic
948770728 2:240250207-240250229 GGTCCCCAGAGCTGTCCCACAGG - Intergenic
1169248998 20:4046086-4046108 TGCCTTCAAAGGTGTCCCACAGG + Intergenic
1175996151 20:62813156-62813178 GGTCTCCGATGGGCTCCCAGGGG - Exonic
1179615216 21:42579214-42579236 GGCCTCCAAGGGGCTCCCAGTGG + Intronic
1180087466 21:45514410-45514432 GGTCTCCCGAGGTGGCTCAGGGG - Exonic
1181549883 22:23631767-23631789 GGTGGCCAGAGGTGTGCCAGAGG + Intronic
1181798509 22:25327765-25327787 GGTGGCCAGAGGTGTGCCAGAGG - Intergenic
1183362392 22:37389488-37389510 GATCTCCAAAGGCTTCTCAGAGG - Intronic
1183831170 22:40419003-40419025 TCTCACCAAAGGTGTCCCCGGGG + Exonic
949231755 3:1757786-1757808 GCTCCCCAAAGGTCCCCCAGTGG - Intergenic
953013714 3:39052442-39052464 GGCCTCCAGGGGTTTCCCAGGGG + Intronic
953482212 3:43261457-43261479 GATGTCCCAGGGTGTCCCAGAGG - Intergenic
953546621 3:43868271-43868293 GGGCTACAAAAGTGTCCCAAGGG + Intergenic
953761146 3:45688403-45688425 GGTGTCTTAAGGTTTCCCAGTGG + Intergenic
954289952 3:49644380-49644402 GGACTCCACAGGAGTCCCCGTGG + Intronic
957218679 3:77354125-77354147 GTTCTCAAAAGGTGTCCAAATGG - Intronic
957465982 3:80591915-80591937 GGACTCCAAATTTGTCTCAGTGG - Intergenic
960333569 3:116391479-116391501 GGGCTCCAGAAGTCTCCCAGGGG - Intronic
961451796 3:127005598-127005620 GGTGTCCCATGGTGACCCAGAGG + Intronic
973177636 4:47227645-47227667 GGTCTCCATGGGTGTACCATTGG - Intronic
975728751 4:77317655-77317677 GGTCTCCAAAGCTGTGGCACAGG + Intronic
975920309 4:79379467-79379489 GGGCTCCCAGGGTATCCCAGAGG - Intergenic
980137373 4:128871790-128871812 GGTCCACAGATGTGTCCCAGAGG + Exonic
980298026 4:130947848-130947870 AGTGTCCAAAGGGGTCCAAGGGG - Intergenic
984025461 4:174538445-174538467 TGTCTCCATAGGTGTTTCAGTGG - Intergenic
999745572 5:154589356-154589378 GGTCCCCAAAGGTGTGTCACTGG - Intergenic
1001139713 5:169134522-169134544 GGTCAAGAAAGGTGTCCCTGAGG - Intronic
1001833310 5:174807934-174807956 CCTCTCCTGAGGTGTCCCAGAGG + Intergenic
1003708725 6:8565080-8565102 GATCTCCAAAGAGGTACCAGGGG + Intergenic
1004396386 6:15248985-15249007 GGTCCCCAAAGGAGTGCCACTGG + Intronic
1005001908 6:21249970-21249992 GAATCCCAAAGGTGTCCCAGGGG + Intergenic
1005401426 6:25438480-25438502 TGTCTCCAAAGGCCTCCCTGTGG + Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1008547674 6:52597842-52597864 GACCTCCATAGGTGTCCCAGAGG + Intergenic
1010095300 6:72036183-72036205 GGTCTCCCTAGGTCTCACAGAGG - Intronic
1013345005 6:109251452-109251474 CGCCTCCAAAGGAGGCCCAGAGG - Intergenic
1022272830 7:28826829-28826851 GATCTCCAGAGGAGTCCCAAGGG + Intergenic
1022509416 7:30925743-30925765 GGTCTCCAAAGTCATCCCACTGG - Intergenic
1023670963 7:42576236-42576258 GGTGTACAAAAGGGTCCCAGTGG - Intergenic
1023965689 7:44962137-44962159 GGTCTCCCAAGGCCTCCCTGTGG + Intergenic
1030516421 7:110544118-110544140 GGTCTCCTAATGTGTCCCATGGG - Intergenic
1032517721 7:132519325-132519347 GGTCTTCAAAGGGGACCCAATGG + Intronic
1034092177 7:148373823-148373845 AGTATCCAAAGGCCTCCCAGTGG + Intronic
1034837161 7:154363101-154363123 GGTTTCCAAAGCTCTCCCAGTGG + Intronic
1037948763 8:23005422-23005444 GGTCTCCAAAGGTGTCCCAGAGG - Exonic
1038507293 8:28095496-28095518 GTTCTACAAAGGTGCCTCAGGGG - Intronic
1039489224 8:37935307-37935329 GGTCTCCAACAGAGTGCCAGAGG + Intronic
1040770597 8:50970654-50970676 TGTCTCCTAAAATGTCCCAGTGG - Intergenic
1043439409 8:80263649-80263671 GCCTTCCAAATGTGTCCCAGGGG - Intergenic
1049534837 8:143174335-143174357 GGTCTCCAAAGGGCACCTAGGGG - Intergenic
1051094041 9:13444547-13444569 GGTCTACAAAACTATCCCAGAGG - Intergenic
1052051729 9:23856365-23856387 GGCCTCCAAAGCTGTCCCTTAGG - Intergenic
1053253388 9:36594178-36594200 GGTCTACAGAGGTATCTCAGAGG - Intronic
1056822715 9:89854766-89854788 GCTCTGCAAAGGGGTCCCTGTGG + Intergenic
1057537680 9:95930192-95930214 GGTCTCCAAAGGATTTCCAGAGG - Intronic
1057790048 9:98118849-98118871 GGAAACCAAAGGTGCCCCAGAGG - Intronic
1059585811 9:115605214-115605236 TGTCTCCAAAAGCTTCCCAGAGG - Intergenic
1060028050 9:120189853-120189875 TGTCGCTGAAGGTGTCCCAGAGG + Intergenic
1060151322 9:121290125-121290147 TGCCTCCAAGGGTATCCCAGAGG + Intronic
1062093967 9:134693612-134693634 GGTCTCCAACAGTGTCCCTTGGG - Intronic
1185736411 X:2500258-2500280 CGTCTCCAGAGGGGGCCCAGAGG - Intronic
1191945464 X:66529995-66530017 GGTGTCCAATGGTGTCCAATAGG + Intergenic
1195848487 X:109255608-109255630 GGTATCCAAAGGACTCCTAGAGG + Intergenic
1198564967 X:137894820-137894842 GGTATCCAAGGTTGTCCTAGGGG + Intergenic
1198635512 X:138694947-138694969 GGTCTCAAAGTGTCTCCCAGTGG + Intronic
1199575036 X:149305848-149305870 CTTCTCCAAAGCTGTTCCAGGGG + Intergenic