ID: 1037950460

View in Genome Browser
Species Human (GRCh38)
Location 8:23015931-23015953
Sequence AATGAGAAGCCCAGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 1, 2: 4, 3: 65, 4: 572}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037950460_1037950463 -5 Left 1037950460 8:23015931-23015953 CCTGCCTCTCTGGGCTTCTCATT 0: 1
1: 1
2: 4
3: 65
4: 572
Right 1037950463 8:23015949-23015971 TCATTCTCAGAGGTATGAAGAGG No data
1037950460_1037950465 13 Left 1037950460 8:23015931-23015953 CCTGCCTCTCTGGGCTTCTCATT 0: 1
1: 1
2: 4
3: 65
4: 572
Right 1037950465 8:23015967-23015989 AGAGGATACTGGACTAAAGTTGG No data
1037950460_1037950464 2 Left 1037950460 8:23015931-23015953 CCTGCCTCTCTGGGCTTCTCATT 0: 1
1: 1
2: 4
3: 65
4: 572
Right 1037950464 8:23015956-23015978 CAGAGGTATGAAGAGGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037950460 Original CRISPR AATGAGAAGCCCAGAGAGGC AGG (reversed) Intronic
900166718 1:1246900-1246922 AGTGAGGAGGCCAGAGAGGACGG - Intergenic
900167086 1:1248156-1248178 AATGGGCAGCCCTGGGAGGCTGG + Intergenic
900487897 1:2932155-2932177 GATGAGAGGCCCAGTGTGGCCGG + Intergenic
900547611 1:3237273-3237295 AATGAGCACCCCAGAGACGGAGG - Intronic
900752379 1:4406811-4406833 AATGAGCGTCCCAGAGAGGGCGG - Intergenic
900847755 1:5117181-5117203 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
901539333 1:9905246-9905268 AATGATCAACCCAGAGGGGCTGG - Intronic
901743353 1:11356490-11356512 AATGAGAAGGCTACAGAGGGGGG - Intergenic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902694976 1:18134207-18134229 AATGGGAAGGCCACAGAGGAGGG - Intronic
902760600 1:18578364-18578386 AGCGAGAAGGCCAGAGGGGCTGG + Intergenic
903064505 1:20691441-20691463 AAAAAGAAGCACTGAGAGGCTGG - Intronic
903487639 1:23702572-23702594 GATCTGAGGCCCAGAGAGGCTGG - Intergenic
903849345 1:26296813-26296835 GAGGAGAGGCCCAGAGAGGTGGG + Intronic
904521676 1:31100712-31100734 AATGAGTTGACCAGAGAGTCGGG - Intergenic
904576251 1:31506915-31506937 AATGAGAAGCAAAGGGAGGCAGG + Intergenic
904997859 1:34645117-34645139 GCTGAGAACCCCAGGGAGGCAGG - Intergenic
905010414 1:34743179-34743201 AGTGAGAAGCCTGGAGAGGCTGG - Intronic
905583267 1:39098322-39098344 AAGCAGAAGCCCAGAGAGTTTGG + Intronic
905772920 1:40649888-40649910 GTTGAGAACCCCAGAGAGGCTGG + Intronic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
906255883 1:44349790-44349812 AAAGTGAAGCCCAGAGAGGAAGG + Intronic
907919628 1:58900524-58900546 GATGAGATGCACAGAGAGGGAGG - Intergenic
907959277 1:59263507-59263529 AAGGTGAAGACCAGAGATGCTGG + Intergenic
908046719 1:60178409-60178431 CACGAGGAGCCCAGAGTGGCTGG + Intergenic
908852679 1:68390319-68390341 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
908953672 1:69594546-69594568 AATATGAAGCCCCAAGAGGCAGG - Intronic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
909910236 1:81249499-81249521 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
909978178 1:82069178-82069200 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
910010364 1:82453676-82453698 CATGAGGAGCCCAAAGGGGCTGG - Intergenic
910318189 1:85913585-85913607 CATAAGAAGCCCAAAGTGGCCGG - Intronic
910415832 1:86997157-86997179 GCTAAGGAGCCCAGAGAGGCTGG + Intronic
910809079 1:91217931-91217953 AGAGAGCAGCCCAGAGAAGCTGG - Intergenic
911504641 1:98733487-98733509 AAGGAAAAGGACAGAGAGGCAGG - Intronic
912813848 1:112813493-112813515 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
912911965 1:113770407-113770429 ATCGAGAAGTCCAGAGAGGTTGG - Intronic
914234858 1:145799888-145799910 TATGAAAAGCCCACAGTGGCTGG - Intronic
914488672 1:148134867-148134889 AATGAGCAGCCGACAGTGGCTGG - Intronic
915056747 1:153140237-153140259 AAAGAGAAGCTCTGAAAGGCCGG + Intergenic
915603172 1:156935243-156935265 GATGAGAAGTCCAGGGAGGGAGG + Exonic
916069191 1:161160055-161160077 CATTTGCAGCCCAGAGAGGCAGG + Intronic
916230263 1:162534558-162534580 ATTGAGAAGCCTGGAGGGGCTGG + Intergenic
918550802 1:185740034-185740056 AGTGAAAAGACCAGAGAGTCTGG + Intronic
918714125 1:187767167-187767189 AATGAGAGGTTCTGAGAGGCAGG + Intergenic
920069331 1:203290900-203290922 CATGAGAAACCCAAAGAGGGAGG - Intergenic
920329321 1:205194044-205194066 ACTGAGAAACCCAGCAAGGCTGG - Intronic
920612695 1:207456867-207456889 AAAGAGAAGGCCAGTGTGGCTGG - Intronic
920693942 1:208167508-208167530 GATGAGAGGCCCATAGAGGTAGG + Intronic
921118924 1:212119762-212119784 GCTGAGGTGCCCAGAGAGGCAGG + Intergenic
921678253 1:218001511-218001533 AAAGAGAAGGCCAGTGTGGCTGG - Intergenic
921732705 1:218595457-218595479 AATGAGAGGTTCTGAGAGGCAGG + Intergenic
921840744 1:219825722-219825744 AGGGAGAAGGCCAGAGAGGTGGG + Intronic
921946669 1:220890650-220890672 AAGGAGTAGCCCAGAGAGTTAGG + Intergenic
922129077 1:222758822-222758844 AATTAGAAACCTAGAGAGGTGGG + Intergenic
922173540 1:223177439-223177461 AAACAGAAGCTCAGAGAGGGGGG + Intergenic
922455270 1:225769190-225769212 GAAGATAAGCCCAGAGAGGGGGG - Intergenic
922577433 1:226671649-226671671 AGGGAGAACCCCAGGGAGGCGGG + Intronic
923734864 1:236596475-236596497 AAGGAGAAACGCTGAGAGGCAGG + Intronic
924609273 1:245560307-245560329 AATGAAAACTCCTGAGAGGCCGG - Intronic
924847933 1:247791545-247791567 GATGAGAAACACTGAGAGGCAGG - Intergenic
1062978542 10:1702696-1702718 AATGTGGGGCCCAGAGAGGCCGG - Intronic
1063282618 10:4647184-4647206 AAGGATAAACCCACAGAGGCAGG + Intergenic
1063395136 10:5679494-5679516 ATTGAGAAGTCAAGAGTGGCAGG + Intergenic
1063430098 10:5980573-5980595 AGTGAGAAGTGCACAGAGGCGGG - Intergenic
1064465576 10:15577006-15577028 AGAGAGAAGCCCAGAGAACCTGG + Intronic
1065442853 10:25770404-25770426 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1065507260 10:26441542-26441564 AATGAGGACTCCAAAGAGGCTGG + Intronic
1066357702 10:34701131-34701153 AATGAGCAGACCAGAGGGACAGG + Intronic
1066930276 10:41749860-41749882 AATGTGGAGCCTACAGAGGCAGG - Intergenic
1067233063 10:44425527-44425549 AATGAGAAACAGAGATAGGCTGG + Intergenic
1068110648 10:52676284-52676306 AGTGATAAGCTCAGAAAGGCAGG + Intergenic
1068225935 10:54107429-54107451 AATCAGAACCCCAGAGGGGGAGG + Intronic
1068273946 10:54767833-54767855 CATGAGAAGCCCAAAGAGTTAGG + Intronic
1068677148 10:59779863-59779885 AATGACAAGGCCAGACAGTCTGG - Intergenic
1069604105 10:69729152-69729174 GACAAGCAGCCCAGAGAGGCCGG + Intergenic
1069659214 10:70112595-70112617 CCTGAGAACCCCAGAGAGGCTGG + Exonic
1070071960 10:73098572-73098594 AATTATAAGACCAAAGAGGCAGG + Intergenic
1070628719 10:78069266-78069288 AATGGGCAGCCCAGAGATTCCGG + Intergenic
1070670817 10:78376203-78376225 AAGTAGCAGACCAGAGAGGCAGG - Intergenic
1070754024 10:78980587-78980609 AATGGGGAGCCCAGGGATGCTGG - Intergenic
1071332588 10:84574642-84574664 AATGAACAGCCCACAGAGGAGGG - Intergenic
1071561062 10:86647151-86647173 ACTCGGAAGCCCTGAGAGGCAGG + Intergenic
1071807775 10:89142968-89142990 AAAGAGAAACCCAGGGAGGAAGG - Intergenic
1071916475 10:90299048-90299070 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1073451041 10:103609391-103609413 CATGACAAGGCCAGATAGGCAGG + Intronic
1074114764 10:110447426-110447448 AATGAGGAGGCCAGAGTGCCAGG - Intergenic
1074212933 10:111354314-111354336 AATCAGAACCCCTGAGAGGAGGG + Intergenic
1074307101 10:112289026-112289048 AGATAGAAGCCCAGAGAGGTTGG - Intronic
1075248976 10:120848892-120848914 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1075368138 10:121911665-121911687 AAAGAAAAGCCCAGAATGGCTGG + Intronic
1075633334 10:124014612-124014634 ACTGAAAAGCCCCGGGAGGCGGG - Intronic
1076168352 10:128300329-128300351 AATGGGAAGGTCAGAGAGGTGGG + Intergenic
1076474127 10:130740624-130740646 AGTGAGAAGCTGAGAGAGACAGG + Intergenic
1077464676 11:2728059-2728081 GAGGAGAAGGCCAGAGTGGCTGG - Intronic
1078361211 11:10669308-10669330 AAAGCTAGGCCCAGAGAGGCGGG - Intronic
1078567987 11:12433738-12433760 GATGCCAAACCCAGAGAGGCCGG - Intronic
1078884083 11:15482523-15482545 AATGAGAACGACAGAGAGGAAGG - Intergenic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079360733 11:19768293-19768315 GATGAGAAGCCCCCAGAGGAAGG - Intronic
1079397955 11:20082294-20082316 AATGAGAAGCACAGGAAGGTGGG + Intronic
1079571172 11:21945056-21945078 ATTGAGAAGCCTAGAAAGCCTGG + Intergenic
1079672293 11:23185595-23185617 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1079887661 11:26007813-26007835 AATGAGAATCTCAGAGAGGTAGG - Intergenic
1080519304 11:33053048-33053070 AATCAGAAACCCTGAGAGGTGGG + Intronic
1080745109 11:35101777-35101799 AAAGTGATGACCAGAGAGGCCGG - Intergenic
1081526295 11:43930048-43930070 AAGGAGCAGCCCTGAGAGGAAGG + Intronic
1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG + Intergenic
1083144397 11:60748113-60748135 AAACCGAGGCCCAGAGAGGCAGG - Intergenic
1083478882 11:62930769-62930791 AAAGAGAAGAACACAGAGGCAGG - Intergenic
1083479072 11:62932241-62932263 AGAGAGGAGCCCAGAGAGCCTGG + Intergenic
1083789486 11:64975250-64975272 CATAAGAAGCCCAAAGTGGCCGG - Intergenic
1084160923 11:67349670-67349692 ACTGAGGAGGCCAGTGAGGCTGG - Intronic
1084209191 11:67613144-67613166 AGGGAGAAGGGCAGAGAGGCGGG + Intergenic
1084717011 11:70880479-70880501 AAAGAGAAAGCCGGAGAGGCAGG + Intronic
1084722154 11:70913816-70913838 AACCAGAAGCACAGAGAGCCTGG - Intronic
1085259492 11:75196058-75196080 AAACTGAGGCCCAGAGAGGCAGG + Intronic
1085394250 11:76198801-76198823 AACATGAAGCCCAGAGAGGTTGG - Intronic
1086397929 11:86435394-86435416 AATGGGAATTCCAGAGAGGGAGG + Intergenic
1086814816 11:91356731-91356753 AACGAGGAGACCAGAGTGGCTGG - Intergenic
1089142209 11:116294600-116294622 CATGAGAAGCCCAAAGTGGCTGG - Intergenic
1089464755 11:118677877-118677899 AATGAGGACTTCAGAGAGGCTGG - Intronic
1089763208 11:120743943-120743965 AACGAGTAGCACAGCGAGGCTGG + Intronic
1089772014 11:120809692-120809714 TATGAGAAGCTCAGAATGGCAGG + Intronic
1089984818 11:122803356-122803378 AAAGGGAAGCCCTGAGAGCCGGG + Intronic
1090239263 11:125170631-125170653 AATTAGAAACCCAGGCAGGCCGG - Intronic
1090382624 11:126337734-126337756 GATGAGAATCCCAGTGCGGCGGG + Intronic
1090850317 11:130566022-130566044 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1090926660 11:131256151-131256173 AATGAGAAGTTCTGAGAGGTGGG + Intergenic
1090985569 11:131762820-131762842 AATGTGAATCACAGAGAGGCTGG + Intronic
1091212631 11:133875170-133875192 CATGAGAAGCCCAAAGTGGTTGG - Intergenic
1091331246 11:134732613-134732635 ATTGGCAAGCCCAGAGAGGCAGG + Intergenic
1091439264 12:499981-500003 CAAGAGCAGCCCAGGGAGGCAGG - Intronic
1092233119 12:6788860-6788882 AGTGAGAAGCCTGGAGAAGCAGG + Intronic
1093797243 12:23327166-23327188 AATTAGAAGCCCTTGGAGGCTGG - Intergenic
1094031969 12:26022364-26022386 AAAGACAAGCCCAGAGAGGGAGG + Intronic
1094411086 12:30169709-30169731 CCCTAGAAGCCCAGAGAGGCTGG + Intergenic
1094840971 12:34342588-34342610 AAGGAGCCGCCCAAAGAGGCAGG + Intergenic
1096103522 12:48983501-48983523 ACCGAGAAGCTCAGAGATGCTGG + Intergenic
1096424633 12:51490744-51490766 AATGAGAAGGAAAGAGAGGCAGG + Intronic
1097416783 12:59324881-59324903 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1097743011 12:63267609-63267631 TTTGGGAAGCCCAGAGAAGCTGG + Intergenic
1097874660 12:64632161-64632183 GAAGAGAAGCCCACACAGGCAGG + Intronic
1097900026 12:64863316-64863338 AAAAGGAAGCCCAGAGAGGTGGG + Intronic
1098158580 12:67625190-67625212 AATGAGGAGACCAAAGAGACTGG - Intergenic
1098745936 12:74236646-74236668 TATGAGAAGCCCAAAGTGGCTGG - Intergenic
1099460473 12:82915141-82915163 GATGAGAAACTAAGAGAGGCAGG + Intronic
1100519320 12:95358051-95358073 TATGAGAAGGCAAGAGAAGCAGG + Intergenic
1100561630 12:95753215-95753237 AATGAGAGGTTCTGAGAGGCGGG - Intronic
1100649803 12:96573009-96573031 AATTTGGAGCCCAGAGAGGCTGG + Intronic
1101720671 12:107347932-107347954 AAGGAGGAGCCCAGAGATGGAGG + Intronic
1101967205 12:109290019-109290041 AAAGAGAGGCCCAGAGAGACTGG + Intronic
1101974483 12:109344138-109344160 ATTGGGAAGACCACAGAGGCAGG + Intergenic
1102541284 12:113621167-113621189 AGTGAGAAGCCCAGATTGGCTGG + Intergenic
1102933448 12:116879254-116879276 AATGAGAAGGAAAGAGAGGAAGG - Intronic
1103109563 12:118263767-118263789 AATGAAAACCCATGAGAGGCCGG + Intronic
1103767334 12:123290050-123290072 AAGAAGAAGCCCAAAAAGGCGGG - Exonic
1103956148 12:124577992-124578014 AATGGGGATCCCTGAGAGGCAGG + Intergenic
1104096168 12:125559992-125560014 AAGCGGGAGCCCAGAGAGGCTGG - Intronic
1104278394 12:127351831-127351853 AAGCGGGAGCCCAGAGAGGCTGG + Intergenic
1105946297 13:25192658-25192680 CAGGAGGAGCCCAGAGTGGCAGG - Intergenic
1106442412 13:29788441-29788463 ACAGAGATGCCCTGAGAGGCTGG + Intronic
1107161543 13:37234854-37234876 AATGAGAATCCCAGAGAGAGAGG + Intergenic
1107505376 13:41028193-41028215 CATGAGGAGCCCAAAGTGGCTGG - Intronic
1107803599 13:44133259-44133281 CATGAGAAGCCCACAGGGTCAGG + Intergenic
1108446064 13:50510251-50510273 CATGAGAAGCAGAGACAGGCTGG - Intronic
1108584446 13:51857352-51857374 AAACAGAAGCACAGAGATGCAGG + Intergenic
1111125768 13:83909940-83909962 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1111127747 13:83934327-83934349 AATGAAAATCCAAAAGAGGCTGG + Intergenic
1111342304 13:86902653-86902675 AATGAGAGGGTCAGAGAGGCTGG - Intergenic
1111445430 13:88341410-88341432 ATTGTGAACTCCAGAGAGGCAGG - Intergenic
1111816291 13:93157281-93157303 TATCAGAAGCTCAGAGAGACAGG - Intergenic
1111937029 13:94568241-94568263 AATCAGAAGCCCTGAGAGTGGGG - Intergenic
1113226748 13:108168132-108168154 GATGGGAAGCCCAGAAAGTCCGG - Intergenic
1114500432 14:23164411-23164433 AATGACTTGCCCAGGGAGGCAGG - Intronic
1114846889 14:26333204-26333226 AGTGAGAAGGCCAGGGTGGCTGG - Intergenic
1115706376 14:36003032-36003054 AATGAGAAGGCTAGAGAGTGAGG + Intergenic
1117116343 14:52517152-52517174 AAAGAGAAGACCAGAGCGGGAGG - Intronic
1117473192 14:56067462-56067484 AATGAGAAGGCAAGGGTGGCAGG + Intergenic
1118011048 14:61610950-61610972 AATGTCAAGCCCAGAGAATCAGG - Intronic
1118841774 14:69518867-69518889 CTTGAGCAGCCCAGAGTGGCTGG + Intronic
1118911285 14:70064094-70064116 CAGGAGGAGCCCAGTGAGGCTGG - Intronic
1119317471 14:73707544-73707566 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1120166606 14:81208143-81208165 CATCAGAAGCCCAGAGACCCAGG + Intronic
1120667952 14:87329522-87329544 AATTTGAAGACCAGAGAGGCTGG - Intergenic
1120761387 14:88288726-88288748 AATGAGAAGACCAGTGTGGCTGG - Intronic
1121111277 14:91314796-91314818 AATAAAAAGCCCAGAGAAGATGG - Intronic
1121815608 14:96925770-96925792 TATAGGAGGCCCAGAGAGGCAGG + Intronic
1121867501 14:97376714-97376736 ACTGAAAAGTCCAGTGAGGCTGG - Intergenic
1124186514 15:27534513-27534535 GATGAGAAGCACAGAGATTCTGG - Exonic
1124626265 15:31309157-31309179 AGTCAGAAGCCCGGGGAGGCTGG - Intergenic
1125081490 15:35678586-35678608 CATGACAACCCCAGAGAGGTGGG - Intergenic
1126432498 15:48601182-48601204 AATGAGACACTCAGAGAAGCTGG + Intronic
1127011196 15:54631100-54631122 ACTGAGAGGCCGAGACAGGCAGG + Exonic
1127137137 15:55935957-55935979 CAAGAGAATCCCAGAGAAGCTGG + Intronic
1127308286 15:57729088-57729110 GATGAGATGCCCAGGGAGGCCGG + Intronic
1128062960 15:64746867-64746889 GGTGAGAAGCCCAGTGAGGTGGG + Intronic
1128666016 15:69538932-69538954 AATGAGAAGCCTTGAGGGGCGGG + Intergenic
1129581761 15:76819132-76819154 GATGTGGAGCCCACAGAGGCAGG - Intronic
1129753814 15:78083913-78083935 AATCTGAGGCACAGAGAGGCTGG - Intronic
1129951908 15:79599498-79599520 GATTAGAAGCACAGAGGGGCCGG + Intergenic
1130293234 15:82623017-82623039 AATGAGAATCCCTAAGAGGTGGG - Intronic
1130615034 15:85398006-85398028 AGACAGAGGCCCAGAGAGGCTGG + Intronic
1131095900 15:89654362-89654384 AGTGAGTAGTCCAGGGAGGCAGG - Intronic
1131217724 15:90553341-90553363 AGTGAGAAGCACAGAGAGTTAGG + Intronic
1131327862 15:91466339-91466361 AATGAGGAGCCCTGAGACTCCGG - Intergenic
1132246166 15:100297931-100297953 AAAGTGAAGTCCTGAGAGGCAGG + Intronic
1132722699 16:1324566-1324588 AAGCAGAAGCCCGGAGAAGCAGG - Intronic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1133282236 16:4673361-4673383 AAAGAGAAGTCCAGAGGGGAGGG - Intronic
1133694566 16:8249576-8249598 AATGAGAACCACAGAGACACAGG + Intergenic
1133837807 16:9382013-9382035 CACAAGCAGCCCAGAGAGGCTGG - Intergenic
1134029444 16:10980030-10980052 AATGAGATGCCCTGAGAGTCTGG - Intronic
1134467573 16:14492874-14492896 AAAGAGAAGTCCAGGGAGGCAGG - Intronic
1134796381 16:17040871-17040893 AATGTGAAGCCCAGAGACGTTGG + Intergenic
1134828825 16:17306884-17306906 AATCTGAGGCCCAGAGAGGCAGG + Intronic
1134846633 16:17446216-17446238 GATGAGCAGCTCACAGAGGCTGG - Intronic
1134887497 16:17806630-17806652 CATGAGAATCACAGAGATGCTGG - Intergenic
1135086406 16:19478113-19478135 AATGAGAAGGCCAGGGAGGCTGG - Intronic
1135721160 16:24819669-24819691 AATGCTCAGCACAGAGAGGCAGG + Intronic
1136039156 16:27564333-27564355 AATGAGTAGCTAAGAGAGACGGG + Intronic
1136559506 16:31030783-31030805 TATTAAAAGCTCAGAGAGGCTGG + Intergenic
1137902292 16:52281684-52281706 AAAGAGATGCCCAGGGATGCAGG + Intergenic
1137905588 16:52318834-52318856 AAATAGAAGGGCAGAGAGGCTGG - Intergenic
1137985032 16:53100009-53100031 GCTGAGGAGCCCAGAGAGGGAGG - Intronic
1138283809 16:55792964-55792986 AGTGAGATGCCCAGAGGCGCTGG - Intergenic
1138285193 16:55804023-55804045 AGTGAGATGCCCAGAGGCGCTGG + Intronic
1138659856 16:58510511-58510533 AAGGACAGGCACAGAGAGGCTGG - Intronic
1138958839 16:62005439-62005461 AATAATATGCCCAGGGAGGCCGG + Intronic
1139038965 16:62980802-62980824 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1139225643 16:65231483-65231505 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1139230312 16:65276912-65276934 AATGAGAGGTCCTAAGAGGCGGG + Intergenic
1139943444 16:70622455-70622477 AATGAGAGGTTCTGAGAGGCGGG + Intronic
1140194627 16:72846237-72846259 CATGGGAAGCTCAGAGAGGGTGG + Intronic
1140864579 16:79048995-79049017 AATGAGAATCCCTGAGGGACAGG + Intronic
1141426819 16:83949625-83949647 GAACAGAAGCCCAGAGAGGGAGG + Intronic
1141472091 16:84245823-84245845 AAGAAGAAGGGCAGAGAGGCAGG + Intergenic
1142160158 16:88553191-88553213 TATGAAAAGCCCAGGGAGCCCGG - Intergenic
1142301835 16:89263114-89263136 AACTAGCAGCCCAGAGAGGCAGG - Intergenic
1203141197 16_KI270728v1_random:1767920-1767942 TGTGAGAAGCTCAGAGAGGCTGG - Intergenic
1142604694 17:1075034-1075056 TATGAGAGCCCCAAAGAGGCTGG + Intronic
1142788489 17:2244372-2244394 AAAGAGAAACCCAGAGGGACTGG + Intronic
1144342318 17:14320021-14320043 ACTGAGAGGGTCAGAGAGGCAGG + Intronic
1144415403 17:15041714-15041736 AAACTGAGGCCCAGAGAGGCTGG - Intergenic
1144810741 17:17997279-17997301 AATCAAAGGCCCAGAGAGCCAGG - Intronic
1146197020 17:30822149-30822171 CATGAGAAGAGCAGAGAGGAAGG - Intronic
1146502361 17:33374943-33374965 AAACAGAAGCCCAGGGAGGTTGG + Intronic
1146598174 17:34187329-34187351 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1147462422 17:40581881-40581903 AATGACAAGTCCAGAGGGACAGG - Intergenic
1147610045 17:41796456-41796478 AAACAGAGGCCCAGAGAGTCTGG - Intergenic
1150150421 17:62804455-62804477 AAAGAAAAAGCCAGAGAGGCAGG + Intronic
1150619941 17:66800519-66800541 ACTGAGAAGCCTGGAGAGGGAGG - Intronic
1151391891 17:73793018-73793040 AATGATAAGCCCAGCCAGGGAGG + Intergenic
1151882348 17:76903243-76903265 AAGGAGGAGCCCAGGGAGGGAGG - Intronic
1151897997 17:76993302-76993324 AAGGAGAAGCCCAGGAAGACTGG - Intergenic
1151999726 17:77637679-77637701 CAAGAGGAGCTCAGAGAGGCAGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153610021 18:6874855-6874877 ACAGAGCAGCCCAAAGAGGCTGG + Intronic
1154490359 18:14917410-14917432 AAAGAGAAGCGCAGATAGACAGG - Intergenic
1155644863 18:28064948-28064970 AAGGACAAGCTGAGAGAGGCAGG - Intronic
1155728594 18:29122411-29122433 AATGAGAAGTCCTGAGAACCAGG - Intergenic
1156133503 18:34007123-34007145 CATGAGAGGCTCAAAGAGGCTGG - Intronic
1156481155 18:37437225-37437247 AATGAGAAGGCAGGAGAAGCAGG + Intronic
1157173773 18:45432278-45432300 AATGATAAGGCCACAGGGGCAGG + Intronic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157690450 18:49677628-49677650 AAATGGAAGCACAGAGAGGCTGG - Intergenic
1158547111 18:58405777-58405799 GGTGAGCAGCTCAGAGAGGCAGG - Intergenic
1159293338 18:66450400-66450422 AATGAGGAGGCCAGAGTAGCTGG + Intergenic
1159835315 18:73328693-73328715 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1160388929 18:78515617-78515639 AATGAGTGGCCAGGAGAGGCTGG - Intergenic
1160701584 19:510075-510097 GAAGAGAAGCCCAGAGCAGCCGG + Intronic
1161288340 19:3479973-3479995 AAGGAGGAGCCCAGAGGGGAGGG + Intronic
1161479306 19:4502718-4502740 AAAGAGAAGCCCCGAGTGGGAGG - Exonic
1161761701 19:6178132-6178154 AATGAGAAGACGGGAGAGGAAGG - Intronic
1162212400 19:9102809-9102831 AATCAGCAGGCCACAGAGGCGGG + Exonic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162897245 19:13772301-13772323 ATTGAAAAACCTAGAGAGGCAGG - Exonic
1163659367 19:18567612-18567634 AAACAGAGGCCCAGAGGGGCAGG + Intronic
1163687411 19:18719609-18719631 AAAGAGCTGCTCAGAGAGGCGGG + Intronic
1164513255 19:28914242-28914264 AAGCAGAAGCCCAGAGAGAGAGG + Intergenic
1164546813 19:29172796-29172818 AAAGTGAAGCCCAGAGAGAGGGG + Intergenic
1164634122 19:29780246-29780268 AGAGAAAAGGCCAGAGAGGCTGG - Intergenic
1164698126 19:30262219-30262241 AATGAGGAGACCAGCCAGGCAGG - Intronic
1165742477 19:38211999-38212021 ATTGAGGAGCTCGGAGAGGCAGG + Exonic
1166102045 19:40576824-40576846 AATGAGCAGCCTATGGAGGCGGG + Intergenic
1166498660 19:43325165-43325187 AATGAGAGGTTCTGAGAGGCAGG + Intergenic
1166737921 19:45097130-45097152 AGTGAGAGGCCCAGAGGGTCTGG + Intronic
1166850295 19:45756855-45756877 TGTGAGAAGCTCAGAGGGGCTGG - Intronic
1167198010 19:48044034-48044056 AAGGAGAAGCCAAGAGAGGCAGG - Exonic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1167514096 19:49912946-49912968 AAAGTGAAGCCCAGAGTGGCTGG + Intronic
1168215525 19:54922398-54922420 AATGGGAAGCCGAGAGAAACGGG + Intergenic
1168327592 19:55546141-55546163 ACGGAGATGCCCAGAGGGGCCGG - Intergenic
926140338 2:10364430-10364452 AATGCGATGGCCAGGGAGGCAGG + Intronic
926463818 2:13165649-13165671 AATGAGAAGTTCTAAGAGGCAGG + Intergenic
926626689 2:15096371-15096393 ATTGTGAGCCCCAGAGAGGCTGG - Intergenic
926751589 2:16202644-16202666 AATCTGAAGCCCAGAGAGGCAGG - Intergenic
926787682 2:16534429-16534451 AATTAGAACCTCAGAGATGCTGG + Intergenic
926815273 2:16793596-16793618 AATGAGAGGTTCTGAGAGGCAGG + Intergenic
927154612 2:20214326-20214348 GCTGAGAAGCCCAGAGACACGGG + Intronic
927283914 2:21336469-21336491 GAGGTGAAGCCCACAGAGGCAGG - Intergenic
927294766 2:21441342-21441364 AATGAGCAGTCCAGAGAAGGGGG + Intergenic
927879904 2:26682926-26682948 AATGAGTAGCTCAGAGAGGAAGG - Intergenic
927997718 2:27497521-27497543 AATGAGAAGCCAAGAAAAGGAGG - Intronic
928175792 2:29033575-29033597 GATGTGAAGCCCAGAGATACAGG - Intronic
928211900 2:29329611-29329633 CATGTGAGGCTCAGAGAGGCTGG - Intronic
928312159 2:30220112-30220134 ATTCAGATTCCCAGAGAGGCAGG - Intergenic
928928847 2:36603089-36603111 AATGAGAGGTTCTGAGAGGCGGG - Intronic
929093966 2:38246599-38246621 AATGAGAAGCCCATCGATGATGG + Intergenic
930675061 2:54191468-54191490 AAAGTGAACCCCAGAGAGTCTGG - Intronic
930955363 2:57197006-57197028 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
931026120 2:58115079-58115101 AATGAGAGGTTCTGAGAGGCGGG + Intronic
931835881 2:66097937-66097959 GAAGAGAAGCCCACAGAGGAGGG + Intergenic
932334932 2:70925087-70925109 TATCAGAAGGCCAGAGTGGCTGG + Intronic
933191309 2:79336981-79337003 AATGAGAGGGCTAGAGAAGCAGG - Intronic
933347418 2:81106647-81106669 AATGGGACACCCAGAGAGCCAGG - Intergenic
933767218 2:85718503-85718525 GAAGAGAAGCCCACAGAGGTAGG - Intergenic
933805893 2:85997836-85997858 GATGGGCAGCCCAGAGAGCCTGG + Intergenic
934029103 2:88025470-88025492 AATGTGAAGCCCTGAGAACCAGG + Intergenic
934468341 2:94287433-94287455 GATCAGAACCCCAGAAAGGCAGG - Intergenic
935034172 2:99352489-99352511 AATGAAAAGGCAAGACAGGCTGG - Intronic
937606535 2:123807765-123807787 AATGTGGAGCCCAGAGAAGTTGG + Intergenic
937863253 2:126729841-126729863 TATGAGAAGCCCATAGAAGCAGG + Intergenic
938389860 2:130896573-130896595 CATGTGAGGCCCAGAGAGGATGG + Intronic
938628231 2:133135337-133135359 GAAGAGAAGCCCAGTGTGGCTGG + Intronic
938698924 2:133859171-133859193 AAGGAGAAGCTGAGATAGGCAGG - Intergenic
938949807 2:136245627-136245649 AATGAGAACGCCAGGGAGGCTGG + Intergenic
939397810 2:141653797-141653819 AATGTGAAGCATAGAGAAGCAGG + Intronic
940544155 2:155062049-155062071 CATGAGGAGCCCAAAGTGGCTGG + Intergenic
941221086 2:162782500-162782522 AATGAGAAGGCCAGTGTGGCTGG + Intronic
945199768 2:207269650-207269672 AAAGAGAAGGCCTGAGAGGTGGG - Intergenic
945237371 2:207643818-207643840 AATGGGAATCCCACAGAGGGAGG + Intergenic
945301150 2:208217514-208217536 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
945924755 2:215791804-215791826 AACAGGAAGCCCTGAGAGGCTGG - Intergenic
946409936 2:219510843-219510865 AATGAGAGTCCCAGAGAAGGGGG - Intergenic
946835076 2:223764352-223764374 AATGAGATGCTCTGAGGGGCTGG - Intronic
948063697 2:235061144-235061166 AGTGAGCAGCTCAGAGAAGCTGG + Intergenic
1168795519 20:608292-608314 TCTGAGAACCCCAGAGAAGCAGG - Intronic
1169222877 20:3836668-3836690 CTTGAGAAGCCCAGAAATGCTGG - Intergenic
1170210377 20:13841356-13841378 AATGAGAAGCCCCGAGGGGATGG - Intergenic
1171346312 20:24469173-24469195 AATGTGAGGGCCACAGAGGCTGG - Intergenic
1171431670 20:25086669-25086691 AGTAAGAAGCCAAGAGAGGTTGG - Intergenic
1172231940 20:33342593-33342615 ATTAAGATGCTCAGAGAGGCCGG + Intergenic
1172768655 20:37364287-37364309 AAACTGAAGCACAGAGAGGCGGG - Intronic
1172991932 20:39042989-39043011 AATGAGCAGGCTAGGGAGGCTGG + Intergenic
1173119134 20:40273065-40273087 AATGAGAGGTCCTGAGAGGTGGG - Intergenic
1173475065 20:43353118-43353140 AATGAGGAGACCAGGCAGGCGGG + Intergenic
1174012974 20:47465505-47465527 AACAAGAAGACCAGGGAGGCCGG - Intergenic
1174306023 20:49614906-49614928 AGTGAGGAGGCCAGAGAGGCTGG + Intergenic
1174411613 20:50340263-50340285 AAAGAGGAGCCCAGTGTGGCAGG - Intergenic
1175394932 20:58651315-58651337 AGTGAGAAGGCCGGGGAGGCAGG + Exonic
1175398029 20:58680952-58680974 AATTAGAACCACAGAGAAGCAGG - Intronic
1175785991 20:61712131-61712153 ACTGAGAAGCCAGGAGAGGCTGG + Intronic
1175862786 20:62159158-62159180 ACAGAGCTGCCCAGAGAGGCTGG - Intronic
1176513268 21:7764399-7764421 ATGGGGAAGGCCAGAGAGGCTGG + Intronic
1178647381 21:34394923-34394945 ATGGGGAAGGCCAGAGAGGCTGG + Intronic
1178662006 21:34514800-34514822 AATCAGGAGGCCAGAGAGGCAGG + Intronic
1178677997 21:34647289-34647311 ACTGAGAGGCCTGGAGAGGCAGG - Intergenic
1179387830 21:40959005-40959027 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1179719784 21:43308447-43308469 CATGAGAAGCCCTGAGAAACGGG - Intergenic
1180083744 21:45498245-45498267 GAGCAGAAGCCCAGAGAGCCAGG + Intronic
1181148060 22:20862805-20862827 TATGAGAAGCCCTGGGAGTCAGG + Intronic
1181573056 22:23778263-23778285 AAGCAGAAGCTCAGAGAGGTTGG - Intronic
1182034114 22:27184062-27184084 AATGAGAGCTCCTGAGAGGCTGG + Intergenic
1183149494 22:36027060-36027082 AATCAGAAGTCCAGAGAAGATGG - Intronic
1183245956 22:36693554-36693576 AAAGGGAAGCCCAGAAAGGTAGG - Intronic
1183358549 22:37371882-37371904 GATGAGCAGCCCAGAGGGGATGG + Exonic
1183558182 22:38548072-38548094 AATGAGAAACCCAGAGACAGAGG - Intronic
1184445994 22:44547243-44547265 GAAGAGGAGCCCAGGGAGGCCGG - Intergenic
1184486424 22:44782833-44782855 AAGGAGAAGCCCAGGAAAGCTGG - Intronic
1184649671 22:45913756-45913778 AGGGAAAAGCCCAGCGAGGCAGG - Intergenic
1185047504 22:48536380-48536402 AAAGACGAGCCCGGAGAGGCAGG + Intronic
1185279900 22:49965555-49965577 AAACTGAAGGCCAGAGAGGCAGG + Intergenic
950140551 3:10612208-10612230 AGTGAAGAGCCCAGAGGGGCTGG - Intronic
950610421 3:14123564-14123586 AATCTGAAGCCCAGAGAAGGAGG - Intronic
951232573 3:20196793-20196815 AATGAGAAGCTGAGATAAGCTGG - Intergenic
952013441 3:28929516-28929538 AATGTGAAGTCCAGGAAGGCAGG - Intergenic
953190038 3:40677153-40677175 AATCTGAAGCCCAGATAGGCTGG - Intergenic
953965394 3:47300934-47300956 AATTAGAATCCCAGTGAGGCCGG - Intronic
954791356 3:53135713-53135735 TATCAGAAGCCCCCAGAGGCTGG - Intergenic
954799669 3:53179978-53180000 AAGCAGAAGCTCAGAGAGGCTGG - Intronic
954807605 3:53229541-53229563 ATTCAGAAGCCCAGAAAGGATGG - Intronic
954876028 3:53803729-53803751 AAAGAGAGCCGCAGAGAGGCAGG + Intronic
954969001 3:54636144-54636166 AATGAGAGGTTCTGAGAGGCAGG + Intronic
955139545 3:56255549-56255571 CAGGAGGAGCCCAGAGAAGCAGG - Intronic
955853275 3:63244334-63244356 AATCAGAAGGCAACAGAGGCTGG + Intronic
956329612 3:68091686-68091708 AAAAAGCAGCCCTGAGAGGCAGG + Intronic
956675547 3:71728869-71728891 AAAGAAAGGCCCAGAGAAGCTGG + Intronic
956711151 3:72039855-72039877 AATGGGGAGCACAGTGAGGCTGG - Intergenic
956718449 3:72098480-72098502 TATGTGAAGCCCAGAAATGCAGG + Intergenic
958040843 3:88224345-88224367 AAACTGAAACCCAGAGAGGCTGG + Intergenic
958914872 3:100038250-100038272 AATGAGAAGAAAAGAGAGGCCGG - Intronic
959288084 3:104441574-104441596 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
959971991 3:112419215-112419237 AATGAGAGGTTCTGAGAGGCAGG + Intergenic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
960402454 3:117218303-117218325 AATCAGATGCCCAAAGAGACAGG + Intergenic
961009231 3:123424878-123424900 AGGCAGAAGGCCAGAGAGGCCGG + Intronic
961730856 3:128963742-128963764 AATGAGAGGTTCTGAGAGGCGGG - Intronic
961800175 3:129441493-129441515 AAACTGAAGCCCAGAGAGGGTGG + Intronic
962745891 3:138396903-138396925 AAGGGGAAGCTCAGAGAGTCAGG + Intronic
962843682 3:139256992-139257014 AATAAGAGGCACAGAGTGGCCGG - Intronic
962891396 3:139676184-139676206 ACTGAGAGGCCCAGAGAGTAGGG - Intronic
962940832 3:140123399-140123421 AATGAGCTTCCCAGAGAGGAGGG + Intronic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
964445722 3:156755267-156755289 AAGGAGATGCCCAGGAAGGCAGG - Intergenic
965358081 3:167702195-167702217 AATGGGGAGGCAAGAGAGGCAGG - Intronic
965454271 3:168878161-168878183 AAGAAGAAGCCCTGAGAGACTGG + Intergenic
965626048 3:170684988-170685010 AATGAGAGGTTCTGAGAGGCAGG + Intronic
965713685 3:171580469-171580491 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
966282630 3:178250567-178250589 AATGGGGAGCCAGGAGAGGCAGG + Intergenic
966832933 3:184026331-184026353 ATTAAGAAGACCAGGGAGGCAGG + Intergenic
966876974 3:184328009-184328031 AGTGGGAGGCCCAGAGAAGCTGG - Intronic
966916581 3:184587607-184587629 AATGAGAAACAGAGAGGGGCAGG - Intronic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
968412646 4:403186-403208 AATGAGAAGTTCCAAGAGGCGGG + Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
969410634 4:7025717-7025739 AAAGGGAGGCCCAGAGAGGAGGG + Intronic
969923386 4:10561629-10561651 AATGAGAATTCCAGAGAGATTGG - Intronic
970069254 4:12138076-12138098 AAGCAGAAGCCCACAGAGCCTGG + Intergenic
970852490 4:20617656-20617678 AATGAGGTGCCCAGTGGGGCTGG - Intronic
971122916 4:23723676-23723698 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
972314098 4:37909195-37909217 AACATGCAGCCCAGAGAGGCTGG - Intronic
972731689 4:41801179-41801201 AATGAGGAGGCTGGAGAGGCTGG - Intergenic
973089976 4:46124129-46124151 AATCAGTAGCCCAAGGAGGCGGG + Intergenic
973185433 4:47322421-47322443 AATGAGGAGTCTACAGAGGCAGG + Intronic
973933734 4:55819885-55819907 AATGAGAAGTTAAGAGAGGGAGG + Intergenic
974904167 4:68035582-68035604 AATGAGAGGCTCTGAGAGGCAGG - Intergenic
975579872 4:75896684-75896706 GATGAGAAGACAAGAGAGGTTGG - Intronic
975749129 4:77504997-77505019 AAGGAGAAGGCCAGAGGGGAAGG + Intergenic
976110389 4:81667198-81667220 AATGAGAAGGCCAGAGAGGCTGG - Intronic
976631559 4:87242814-87242836 AATGAGAATCCCAGAAGGGTAGG + Intergenic
977164956 4:93683155-93683177 AAGGAGAAGCCCAGGGAGAGAGG - Intronic
977216889 4:94294906-94294928 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
977752950 4:100631697-100631719 CATTAAAAGCCCAGAGTGGCAGG + Intronic
978000853 4:103555422-103555444 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
978251988 4:106641779-106641801 AATGAGAAAAACAGAGAGGAGGG - Intergenic
980913836 4:139016249-139016271 AATGAGAAGCCCGGGGCTGCCGG + Intronic
981321045 4:143391597-143391619 ACAGAGAAGCACAGAGAAGCGGG + Intronic
981585961 4:146302667-146302689 ACTGAGAAAACCAGAGAGGCTGG + Intronic
981774179 4:148346102-148346124 AGGGTGAAGCCCAGAAAGGCAGG + Intronic
982180207 4:152742991-152743013 AATGAGAGGTTCTGAGAGGCAGG + Intronic
982788014 4:159558730-159558752 AATGAGGATCCCAGGGTGGCTGG + Intergenic
983345865 4:166524789-166524811 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
983360683 4:166720360-166720382 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
983488006 4:168353978-168354000 TATGATGAGCCCAGACAGGCTGG + Intergenic
984593376 4:181640682-181640704 AATGAGATGACCACAGAGTCTGG - Intergenic
985100121 4:186450548-186450570 ACTGAGAAGAGCAGAGCGGCTGG - Intronic
985389584 4:189481026-189481048 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
985582618 5:706837-706859 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
985953672 5:3243828-3243850 CATGAGGAGCCCAAAGTGGCTGG + Intergenic
986169120 5:5301634-5301656 AAGCAGAAGCCCAGAGAGCTTGG - Intronic
986193796 5:5519594-5519616 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
986619377 5:9655838-9655860 AAAGAGAAAACCACAGAGGCAGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987269783 5:16294773-16294795 AATGAGAAACCCAGTGACACTGG - Intergenic
987753424 5:22069639-22069661 AATGAGGAACTCAGAGAGGCTGG - Intronic
988910204 5:35832469-35832491 AATGAGAAGACCAGACAGCTGGG - Intergenic
988987460 5:36634681-36634703 GAGGAGAGGACCAGAGAGGCAGG - Intronic
988992418 5:36684375-36684397 AATGGGAAGCACACAGAGGCAGG - Intronic
990120670 5:52447200-52447222 TACCAGAAGCCCAGAGTGGCTGG + Intergenic
992451669 5:76881570-76881592 AATGAGAAGTTCTAAGAGGCGGG + Intronic
993834613 5:92802501-92802523 ATTGACAAGCCCAGAAAAGCAGG - Intergenic
993849604 5:92990477-92990499 AATGAGTATGACAGAGAGGCTGG + Intergenic
994032909 5:95165903-95165925 TATGACAAGCCCTGAGAGGGAGG - Intronic
994614969 5:102092617-102092639 CATCACAAGCCCAGAGACGCAGG - Intergenic
995667430 5:114558629-114558651 AATGAAAAGACAAGAGAGGGTGG + Intergenic
995899102 5:117048032-117048054 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
997852604 5:137346209-137346231 AATGAGAAGCCCAGGAAGACCGG + Intronic
998267661 5:140678162-140678184 GGTGAGAAGCCCAAAGATGCCGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999449325 5:151666469-151666491 AATGAGAAGCGCCTGGAGGCAGG - Exonic
999805162 5:155074303-155074325 AATGAAAAACCCAGAGATACAGG + Intergenic
1000038463 5:157466945-157466967 AAGGAGCAGCCCTTAGAGGCCGG + Intronic
1001031779 5:168268627-168268649 GGTGAGAAGTTCAGAGAGGCCGG + Intergenic
1001104759 5:168843707-168843729 TTAGAGAAGCCCAGAGAGGAAGG - Intronic
1001253245 5:170164890-170164912 AATGACAACCACAGAGTGGCTGG - Intergenic
1001420555 5:171583230-171583252 AAACAGAAGCACAGAGAGTCTGG + Intergenic
1001460315 5:171906561-171906583 AAGAAAAAGCCCAGAGAGGCAGG - Intronic
1002211105 5:177599985-177600007 AAGGAGCCGCCCAGAGAGGGAGG + Intergenic
1002303776 5:178271970-178271992 CAGCGGAAGCCCAGAGAGGCAGG - Intronic
1002602391 5:180361518-180361540 AATGGGAAGCCCTGAGAACCTGG + Intergenic
1002640141 5:180626843-180626865 AATGAGTGTCCCAGCGAGGCAGG - Intronic
1003036823 6:2647383-2647405 AATGTGCTGCCCAAAGAGGCAGG - Intergenic
1003429907 6:6029452-6029474 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1003716184 6:8648960-8648982 AATGAGAGGCTAACAGAGGCAGG - Intergenic
1003888245 6:10540273-10540295 AGTGAGAAGCCTGGAGAGGTAGG - Intronic
1004271654 6:14201304-14201326 TCTGAGGAGGCCAGAGAGGCAGG - Intergenic
1005897693 6:30192024-30192046 TGTGAGCAGCCCAGAGAGGGTGG + Intronic
1006167244 6:32072190-32072212 CATGAGAGGCCCACAGAGTCAGG + Intronic
1006251467 6:32790624-32790646 AATAAGAAGGCCAGTGAGGCTGG + Intergenic
1006397721 6:33797936-33797958 AGTGAGGAGGCCAGAGAGACTGG - Intronic
1008010051 6:46456928-46456950 AATGAGGAGCCCAGGGCAGCAGG - Exonic
1010846832 6:80720050-80720072 AATGAGGAGCACAGAGAGAGAGG + Intergenic
1012066274 6:94555601-94555623 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1013033220 6:106356422-106356444 AATCAGAAGCTCAGTGATGCTGG - Intergenic
1013968216 6:115982322-115982344 AAGTAGAAACCCAGAAAGGCTGG - Intronic
1014396340 6:120929225-120929247 AATGAGAGGTTCAAAGAGGCGGG - Intergenic
1014454602 6:121622092-121622114 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1014614400 6:123583951-123583973 AATGAGAGGTTCAAAGAGGCGGG + Intronic
1014628597 6:123761048-123761070 AATAAGAAGGCCAGTGGGGCTGG + Intergenic
1014748195 6:125224633-125224655 CAAGAGTAGCCCAGAGAGGCAGG + Intronic
1014891810 6:126852794-126852816 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1015287779 6:131505997-131506019 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1015479187 6:133689540-133689562 CATGGGAAGCCCAAAGTGGCCGG + Intergenic
1015911269 6:138169612-138169634 AAAGGGAAGCCCTGAGATGCAGG - Intronic
1016997986 6:149974481-149974503 AATGAGATGTGCATAGAGGCTGG + Intergenic
1017389775 6:153925541-153925563 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1017452558 6:154567310-154567332 CATGAGGAGCCCAAAGTGGCTGG - Intergenic
1018084223 6:160288234-160288256 AATGAGAAGTTCTAAGAGGCGGG + Intergenic
1018101859 6:160447240-160447262 AGTGAGGAGCCCAAAGAGACAGG + Intronic
1018357117 6:163029390-163029412 CATGAGGTGCTCAGAGAGGCTGG - Intronic
1018358850 6:163045243-163045265 AGGCAGAAGCCCAGAGGGGCTGG - Intronic
1018468733 6:164078204-164078226 AATCAGAATCCCAAAGAGGAAGG - Intergenic
1018734323 6:166676017-166676039 AATGAAAAGTCCTGGGAGGCCGG + Intronic
1019413914 7:918891-918913 AATGAGATGCCAGGAGAAGCAGG + Intronic
1019682801 7:2361713-2361735 AGAAAGAAGCTCAGAGAGGCCGG - Intronic
1021479198 7:21097069-21097091 AATGAGAAGGCAGGAGAGGATGG + Intergenic
1021909941 7:25375478-25375500 ATAGAGAAACCCAGAGAGGCTGG - Intergenic
1022039549 7:26567161-26567183 AATGACAAGCCCAGGCAGGGTGG + Intergenic
1022326653 7:29338263-29338285 AATCTGAAGCCCACAGAGGATGG - Intronic
1022491081 7:30818537-30818559 AATCTGAAGCCCAGAGAAGCTGG + Intronic
1022495675 7:30851689-30851711 AAACAGAAGCCCAGAGAGGGAGG + Intronic
1022522087 7:31015010-31015032 AATTGGGACCCCAGAGAGGCTGG + Intergenic
1022854479 7:34301788-34301810 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1023605505 7:41927429-41927451 AATGACAAAACCAGATAGGCTGG - Intergenic
1023787220 7:43719830-43719852 AAAGAGAACACCAGAGAAGCTGG + Intronic
1024064458 7:45720914-45720936 AATCTGAGGCCCAGAGAGGTTGG + Exonic
1024329296 7:48140357-48140379 AGAGAGCAGCCCAGAGAAGCTGG - Intergenic
1025986781 7:66460267-66460289 AATGATAGGAGCAGAGAGGCTGG - Intergenic
1026967513 7:74449865-74449887 AAGCTGAAGCCCAGAGAGGCTGG + Intergenic
1027153573 7:75750513-75750535 AATGGGAAGCCCAGCCAGACAGG + Intergenic
1027210052 7:76139107-76139129 AATGATAGGAGCAGAGAGGCTGG - Intergenic
1027546288 7:79531299-79531321 CATGAGGAGCCCAAAGTGGCGGG + Intergenic
1027703089 7:81493546-81493568 CATGAGAAGACCAGAGAGATGGG + Intergenic
1028831133 7:95327602-95327624 AATGAGAAGCCACAAGAGGGAGG - Intergenic
1030163234 7:106529332-106529354 AATGAGAAGTTCTGAGAGGCGGG + Intergenic
1030192619 7:106824648-106824670 CATGAGAAGCCCAAAGTGGGTGG - Intergenic
1030334389 7:108308750-108308772 ACTGAGCAGCCCAGAGTGGTGGG + Intronic
1031051740 7:116952302-116952324 AAACAGTAGCCGAGAGAGGCTGG + Intergenic
1031712934 7:125072246-125072268 CATGAGCAGCCCAGAGAGGAAGG - Intergenic
1033378823 7:140792247-140792269 AATGGGAAACACATAGAGGCAGG - Intronic
1033547748 7:142417093-142417115 AAAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033675677 7:143538884-143538906 AATGAGAGGTTCTGAGAGGCCGG + Intergenic
1034037098 7:147836360-147836382 AAAGAGAAGACCAGTGTGGCTGG - Intronic
1034260558 7:149752804-149752826 ATGGGGAAGCCCAGGGAGGCCGG + Intergenic
1034310314 7:150082089-150082111 ATTGAAAAGCCCAGACAAGCTGG + Intergenic
1034717075 7:153253369-153253391 AAGGAAAGGCCCTGAGAGGCAGG - Intergenic
1034796531 7:154018564-154018586 ATTGAAAAGCCCAGACAAGCTGG - Intronic
1035076166 7:156179041-156179063 AATAAGAGCCGCAGAGAGGCCGG + Intergenic
1035313883 7:157986393-157986415 AAACTGACGCCCAGAGAGGCAGG + Intronic
1035356810 7:158280607-158280629 AAGGAGGAGCCGAGAGAGCCTGG + Intronic
1035740966 8:1928550-1928572 GAGGAGAAGCGCAGAGAGCCTGG + Exonic
1037291996 8:17360860-17360882 AACTTGAAACCCAGAGAGGCCGG - Intronic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1038101978 8:24387928-24387950 AAAGAGCAGCCCGGAGAAGCTGG + Intronic
1039527032 8:38226125-38226147 CATGAGGAGCCCAAAGTGGCTGG + Intronic
1039580846 8:38665835-38665857 AATCAGAATCCCAGGGAGGAAGG - Intergenic
1039745205 8:40419413-40419435 AGCCAGAAGCCCAGAGAAGCAGG - Intergenic
1040538416 8:48329837-48329859 AAATGGAAGCACAGAGAGGCTGG - Intergenic
1041235946 8:55802322-55802344 AATGACACGCCCAGAGAAACAGG - Intronic
1043353400 8:79387763-79387785 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1044258351 8:90091876-90091898 AATGAGAGGTTCTGAGAGGCGGG + Intronic
1044439788 8:92209705-92209727 AGTGTGAAGGCCAGAGAGCCAGG - Intergenic
1045197799 8:99947923-99947945 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1045555793 8:103213452-103213474 AAAGAGAAGACCAGAGTGGTTGG + Intronic
1045645049 8:104289988-104290010 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1047011949 8:120682486-120682508 AAGGAGAAGTTCAGAGAGGTTGG - Intronic
1047211559 8:122844384-122844406 AATGCGAAGCTCAGAGAAGGTGG - Intronic
1047240751 8:123085949-123085971 AAACGGAAGCCCAGAGAGGTTGG - Intronic
1047327253 8:123851681-123851703 TATGAGGAGCCCAAAGTGGCTGG + Intergenic
1047595088 8:126370283-126370305 AAACAGAAGCCCAGAGCTGCAGG + Intergenic
1047788333 8:128176437-128176459 AAGTAGAAGCCCAGAGAAGGAGG + Intergenic
1047829273 8:128613570-128613592 AATGAGAAGTTCTAAGAGGCAGG + Intergenic
1048322478 8:133410944-133410966 AAAGAGAAGGCCGGACAGGCAGG - Intergenic
1048461892 8:134628012-134628034 AATGAGAAGCCCAGATCTGCTGG + Intronic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1048943299 8:139421698-139421720 ACTAAGAAGCCCAGAGATGCTGG - Intergenic
1049353462 8:142176527-142176549 AATGAGAATCCGAGAAGGGCCGG - Intergenic
1049478651 8:142809576-142809598 AAGTACAAGCACAGAGAGGCGGG + Intergenic
1049833443 8:144717251-144717273 AATAAAAAGCTCAGGGAGGCCGG - Intergenic
1049850395 8:144827364-144827386 GACCAGAAGCCCAGATAGGCGGG - Intergenic
1049953935 9:673981-674003 ACTGGGAAGACCAGAGAGGGAGG - Intronic
1050116657 9:2270563-2270585 AATAAAAAACCCCGAGAGGCTGG + Intergenic
1050117784 9:2278848-2278870 AGTGAAAAGCGAAGAGAGGCTGG - Intergenic
1050203336 9:3172358-3172380 AATGAGAAACCTTGAGAGGAAGG - Intergenic
1050366227 9:4876288-4876310 AAGGAGATGTCCAGAGTGGCAGG + Intronic
1050574035 9:6974016-6974038 ATTGAAAAACCCAAAGAGGCTGG + Intronic
1051043692 9:12848025-12848047 AATTATAAGCCCAGAGAAGGGGG + Intergenic
1051356943 9:16248028-16248050 CAAGAGAACACCAGAGAGGCTGG - Intronic
1052500664 9:29285274-29285296 AAAGAGAAGGCAAGAGAGGTGGG + Intergenic
1053278773 9:36802960-36802982 AATGAGGAACCCAGTGAGACTGG + Intergenic
1053295255 9:36908254-36908276 AAAGAGAAGCCAAGAGTGGATGG + Intronic
1053526120 9:38832705-38832727 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054198347 9:62057130-62057152 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054459930 9:65457169-65457191 TGTGAGAAGCTCAGGGAGGCAGG - Intergenic
1054640007 9:67531233-67531255 CAGAGGAAGCCCAGAGAGGCTGG - Intergenic
1056772237 9:89486607-89486629 AAAGAAAACCCCAGACAGGCTGG + Intronic
1056818955 9:89823370-89823392 AATGAGAAACCCAAAATGGCAGG - Intergenic
1057378260 9:94543862-94543884 AATGAGAGGTTCTGAGAGGCAGG - Intergenic
1057548808 9:96037354-96037376 AAACAGTAGCCCAGAGAGGCCGG + Intergenic
1057982357 9:99674209-99674231 AATGAGAGGTTCTGAGAGGCGGG - Intergenic
1058659130 9:107252890-107252912 AATGAGAAGACAAGAGAGAAGGG + Intergenic
1059176664 9:112174952-112174974 AAGGAGGAGCTCAGAGAAGCGGG - Intronic
1059371516 9:113843346-113843368 AGTGAGAAGTACAGAGTGGCAGG + Intergenic
1059427378 9:114229606-114229628 AAACAGAGGCCCAGAGAGGTTGG + Intronic
1059863186 9:118487116-118487138 AATGAGAAGTTCTAAGAGGCGGG + Intergenic
1060399341 9:123339103-123339125 AAACCGAAGCACAGAGAGGCAGG - Intergenic
1060419971 9:123461345-123461367 AATCAGAAGCTCAGGGATGCTGG + Intronic
1060666323 9:125434160-125434182 AGACAGAGGCCCAGAGAGGCTGG + Intergenic
1060737566 9:126076070-126076092 AATGAGAGGTCCTAAGAGGCGGG + Intergenic
1061311807 9:129768406-129768428 CATGAGGAGCCCAAAGTGGCCGG + Intergenic
1061411347 9:130423569-130423591 AAACAGACGCACAGAGAGGCTGG + Intronic
1061656783 9:132098017-132098039 AGTGAGGAGACCAGAGTGGCTGG + Intergenic
1061662845 9:132141729-132141751 AGTGAGAAGCCCGCAGGGGCAGG + Intergenic
1061794051 9:133073769-133073791 AATGTGAAATTCAGAGAGGCAGG + Intronic
1061926081 9:133806698-133806720 AATGAGACGGCCAGGGAGGCAGG + Intronic
1062081044 9:134623592-134623614 AGTGTGAAGCCCAGAGGCGCCGG - Intergenic
1185552846 X:997838-997860 TGTGAGAAGCTCAGAGAAGCAGG + Intergenic
1187018331 X:15352729-15352751 AAAGAAAAGCCCAGAGTGGTTGG - Intronic
1187041712 X:15603457-15603479 AATTAGAAGACCAAAGATGCAGG + Intergenic
1187366129 X:18667020-18667042 AAGGGGGAGCCCAGACAGGCTGG + Intronic
1188552970 X:31381765-31381787 AATGAGAAGTTCTAAGAGGCAGG - Intronic
1188568396 X:31552606-31552628 AAGGAGCAGCCCAGAGGAGCAGG - Intronic
1189481119 X:41393090-41393112 CAAGAGAAGCTGAGAGAGGCAGG + Intergenic
1192213947 X:69144938-69144960 AAAGGGAGGCCCAGAGAGGCTGG - Intergenic
1192909399 X:75587030-75587052 AATGTGGAGCCTACAGAGGCAGG - Intergenic
1193531221 X:82657024-82657046 CATGAAAAGCCCAAAGTGGCAGG + Intergenic
1193923252 X:87455200-87455222 AATGTGGAGCCCAGAGAGTTTGG + Intergenic
1194185981 X:90774985-90775007 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1194293347 X:92101901-92101923 AATGAGAGGTTCTGAGAGGCGGG + Intronic
1194308272 X:92274728-92274750 AATGAGAGGTTCTGAGAGGCGGG + Intronic
1194384072 X:93231572-93231594 ATTGAGAAGGCCAGAGGGGTTGG + Intergenic
1196205741 X:112937395-112937417 AAGGAGCAGCCTAGAAAGGCAGG + Intergenic
1196763172 X:119218567-119218589 AAATAAAAGCCCAGATAGGCTGG - Intergenic
1196773595 X:119319438-119319460 AATGAGAGGTTCTGAGAGGCGGG + Intergenic
1197732558 X:129823703-129823725 AATGGGAGGCCCGGGGAGGCCGG + Exonic
1198861084 X:141071203-141071225 CATGAGAAGAGCAGAGAGTCAGG + Intergenic
1198901608 X:141516180-141516202 CATGAGAAGAGCAGAGAGTCAGG - Intergenic
1199013341 X:142782305-142782327 AATGAGGAGCCCAAAGTGTCTGG - Intergenic
1199386961 X:147233919-147233941 AATGAGGATCACAAAGAGGCAGG + Intergenic
1199528696 X:148822924-148822946 AATCAGAGGCCCAGACAGCCAGG - Intronic
1199941306 X:152630526-152630548 AATAAGGAGGCCAGTGAGGCTGG - Intergenic
1200532583 Y:4357065-4357087 AATGAGAGGTTCTGAGAGGCGGG + Intergenic