ID: 1037950833

View in Genome Browser
Species Human (GRCh38)
Location 8:23017943-23017965
Sequence AAGCCTACTCACACCCTCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037950828_1037950833 26 Left 1037950828 8:23017894-23017916 CCACCGACGGACTTGAGTGTTGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1037950833 8:23017943-23017965 AAGCCTACTCACACCCTCACTGG 0: 1
1: 0
2: 0
3: 4
4: 133
1037950829_1037950833 23 Left 1037950829 8:23017897-23017919 CCGACGGACTTGAGTGTTGCATT 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1037950833 8:23017943-23017965 AAGCCTACTCACACCCTCACTGG 0: 1
1: 0
2: 0
3: 4
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037950833 Original CRISPR AAGCCTACTCACACCCTCAC TGG Exonic
900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG + Intronic
901880512 1:12191259-12191281 AAGCCTCTTCACAGCCCCACGGG + Intronic
903017020 1:20367748-20367770 AAGCCTCCCCACTCTCTCACTGG + Intergenic
908401475 1:63775475-63775497 AAGGCTCCTCACCCCCTCAAGGG - Intronic
910227992 1:84956131-84956153 AAGCCTAATCACCCCTTCATAGG + Intronic
915340341 1:155173869-155173891 AGCCCTCCTCACACCCCCACTGG + Intronic
915704002 1:157825998-157826020 AGACCTACTCACACACACACTGG - Intergenic
922132665 1:222795128-222795150 AGGCCTCCTCCTACCCTCACAGG + Intergenic
922504062 1:226116286-226116308 AAGCGGCCTCACACCCTCAGTGG - Intergenic
1062764452 10:50020-50042 ATGCTTACTGACACCTTCACTGG - Intronic
1064669288 10:17692991-17693013 CAGCCTAGGCACACCCTCCCAGG - Intronic
1076856935 10:133121539-133121561 AAGCACACTCACACACACACTGG - Intronic
1076856944 10:133121710-133121732 AAGCACACTCACACGCACACTGG - Intronic
1076856947 10:133121790-133121812 AAGCACACTCACACACACACTGG - Intronic
1076856955 10:133121930-133121952 AAGCACACTCACACACACACTGG - Intronic
1077002865 11:333441-333463 CAGCTTAGTCTCACCCTCACTGG + Intergenic
1078957045 11:16210680-16210702 CAGCCTTCTCTCACACTCACAGG + Intronic
1080869500 11:36225208-36225230 AAACCTCCTCACTGCCTCACAGG + Intronic
1081459006 11:43253680-43253702 AAGCCTATTCACAACCAGACTGG - Intergenic
1084539810 11:69778891-69778913 AAGCCTCTTCACTCCTTCACGGG - Intergenic
1085530207 11:77187924-77187946 AAGGCTAGTCACTACCTCACCGG + Intronic
1089633081 11:119795568-119795590 ACCCATCCTCACACCCTCACTGG - Intergenic
1089637420 11:119824277-119824299 CTGCCTACTCTCACCCTCCCTGG - Intergenic
1090658388 11:128862621-128862643 ATCCCTACTCATCCCCTCACGGG + Intronic
1090918837 11:131190726-131190748 CAGCCCACTCCCACCCTCAGTGG - Intergenic
1094680325 12:32661641-32661663 AAGCCTGCTCATAACATCACTGG - Intergenic
1095193912 12:39290168-39290190 AAGACTTCGCACACCCTCTCAGG - Intergenic
1096718448 12:53504635-53504657 AAGGCTTCTCACACCCACGCTGG - Intronic
1104963919 12:132500672-132500694 CAGCCCATTCACACCCTTACAGG + Intronic
1104963936 12:132500730-132500752 CAGCCCATTCACACCCTTACAGG + Intronic
1110831395 13:80035657-80035679 AACATTTCTCACACCCTCACAGG + Intergenic
1111040864 13:82745489-82745511 AAGCAAACTCACTCCATCACAGG + Intergenic
1112715655 13:102181912-102181934 GATCCTACTCAGAACCTCACAGG + Intronic
1118191079 14:63580933-63580955 AAGCCTCGTCACACCCTAAGTGG - Intergenic
1118355364 14:65009157-65009179 AAGCTGACTAATACCCTCACCGG - Intronic
1120398319 14:83996111-83996133 AAGGCCATTCTCACCCTCACTGG + Intergenic
1126263109 15:46717702-46717724 AAGTCTACTAATAGCCTCACAGG + Intergenic
1128599190 15:68981269-68981291 AAGCTTATGCCCACCCTCACAGG + Intronic
1129326768 15:74803895-74803917 AAGCCTCCTCACACCTTCAGAGG - Intergenic
1131100290 15:89683362-89683384 AAGCCTAAAAACACCCTAACGGG + Exonic
1133300260 16:4778066-4778088 CAGGCTCCCCACACCCTCACCGG + Exonic
1137496347 16:48972025-48972047 AATCCTAGGGACACCCTCACTGG - Intergenic
1139011733 16:62643302-62643324 AGTCCTACTCACACCTTCAGGGG - Intergenic
1142257723 16:89023192-89023214 ACACACACTCACACCCTCACAGG + Intergenic
1142257730 16:89023344-89023366 ACGCATACACACACACTCACAGG + Intergenic
1143075624 17:4340348-4340370 AAATCTACTCAAACTCTCACTGG - Intronic
1144126241 17:12205570-12205592 AAGCCTTCTCACATCATCCCAGG - Intergenic
1144781439 17:17810299-17810321 AAGCCGTCTCCCACCCTCGCCGG - Exonic
1152803726 17:82344642-82344664 CAGCCTACGCACACACACACGGG - Intergenic
1152894932 17:82905514-82905536 AAGCCCACACGCACCCACACAGG - Intronic
1152894949 17:82905582-82905604 AAGCCCACACGCACCCACACAGG - Intronic
1152894966 17:82905650-82905672 AAGCCCACACGCACCCACACAGG - Intronic
1152894983 17:82905718-82905740 AAGCCCACACGCACCCACACAGG - Intronic
1152895000 17:82905786-82905808 AAGCCCACACGCACCCACACAGG - Intronic
1152895018 17:82905854-82905876 AAGCCCACACGCACCCACACAGG - Intronic
1155547465 18:26930147-26930169 AAGCCTGCTCTAACCCTCACTGG + Intronic
1158370516 18:56797263-56797285 AAGCCTACTGAGGGCCTCACAGG - Intronic
1162173443 19:8810381-8810403 AAGCCTTCTGAGACCTTCACAGG + Exonic
1164699908 19:30277974-30277996 AATCCAACTCACACTCTCTCTGG + Intronic
1166120522 19:40683635-40683657 AATCCTGCTCTCCCCCTCACAGG + Intronic
1168126388 19:54285803-54285825 AGGCCTCCCCACACCCTCCCTGG - Intergenic
1168175507 19:54625061-54625083 AGGCCTCCCCACACCCTCCCTGG + Intronic
935074122 2:99723993-99724015 AACCCTGCTGACACCCTGACTGG + Intronic
936929632 2:117774392-117774414 AAGCCTTCCCACCACCTCACTGG - Intergenic
937825861 2:126368071-126368093 AAGCCAACACACACCTTAACAGG - Intergenic
937826025 2:126369294-126369316 CAACCTTCTCAGACCCTCACAGG - Intergenic
944831057 2:203534805-203534827 AAGCCTAACCGCACCCTCCCAGG + Intronic
946300599 2:218821611-218821633 AAGCCTCCTCTCTCCCCCACTGG + Intergenic
946960080 2:224975884-224975906 AAGCTTGATAACACCCTCACTGG + Intronic
1170519177 20:17166031-17166053 CAACCTACTCAGACCCTCGCTGG - Intergenic
1176240964 20:64075687-64075709 AGCCCCACTCCCACCCTCACAGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177370431 21:20196701-20196723 CAGCCTCCTCAGACCCCCACTGG - Intergenic
1177714729 21:24824242-24824264 AACCCTACCCCGACCCTCACTGG - Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1181613488 22:24035659-24035681 AAGCAATCTCACACCCTCAAAGG - Intronic
1182059627 22:27387794-27387816 AAGCACACACACACGCTCACAGG + Intergenic
1185092714 22:48785000-48785022 AACCCTAATCACCTCCTCACAGG - Intronic
1185156124 22:49194522-49194544 AGGCCTGCCCACACCCACACAGG + Intergenic
950435796 3:12979062-12979084 ACTCCTGCTTACACCCTCACAGG - Intronic
966584424 3:181605442-181605464 AAGGCTACGCACTCCCTCCCTGG - Intergenic
970616514 4:17773143-17773165 AAGAATACTGACACCCTCCCGGG + Intronic
971027926 4:22606871-22606893 AAGCCTGGTCTAACCCTCACCGG + Intergenic
974195171 4:58565024-58565046 CAGGCCACTGACACCCTCACAGG - Intergenic
980548333 4:134299569-134299591 CAGCCTCCTCAGACCCTCCCTGG + Intergenic
983155136 4:164337641-164337663 TAGCCTACAGACACCCTCAATGG + Intronic
985341497 4:188959502-188959524 ACGCTTACTCACACTGTCACGGG - Intergenic
986928568 5:12790718-12790740 CAGTCTACTCAAACCCTCACTGG + Intergenic
990493852 5:56327165-56327187 ACTTCTACTCACACCTTCACGGG - Intergenic
992837046 5:80651906-80651928 TAGCCTAGCCACACCCCCACGGG - Intronic
994844290 5:104966476-104966498 AGGTCTACACACACACTCACAGG - Intergenic
998354031 5:141519705-141519727 AGGCCAAATCACACCCTCCCTGG - Intronic
999588258 5:153115366-153115388 AAGCACACTCACCTCCTCACAGG + Intergenic
1000966900 5:167668362-167668384 AAACCTCATAACACCCTCACAGG - Intronic
1001872063 5:175165223-175165245 AATCCTGCTCTGACCCTCACTGG - Intergenic
1003005445 6:2376873-2376895 AAACCCACTCACACCCTTGCTGG + Intergenic
1005836083 6:29710641-29710663 GAGCCTCCACCCACCCTCACAGG + Intergenic
1007419828 6:41712830-41712852 AAGCCTCCCCACCCCCTCCCAGG + Intronic
1016622567 6:146129385-146129407 AAACATACTCACACACACACGGG - Intronic
1018051712 6:160015010-160015032 ACACCTACTCACAGCCTCAAAGG - Intronic
1019595101 7:1854767-1854789 AAGTCTCCTCTCAACCTCACTGG + Intronic
1020997077 7:15278717-15278739 CAGCCTACTCACTCCCTCCCTGG + Intronic
1022509582 7:30926538-30926560 TAGCCTCGGCACACCCTCACAGG - Intergenic
1023601460 7:41885518-41885540 AAGCCTTAACAGACCCTCACAGG - Intergenic
1023800183 7:43827050-43827072 GAGCCAACTGAGACCCTCACAGG - Intergenic
1026895492 7:74007880-74007902 AAACCAGCTCACACCCTCAGAGG - Intergenic
1029238308 7:99142277-99142299 ATCCCTACTCCCACACTCACTGG - Intronic
1031458322 7:122011999-122012021 CAGCCTACTCATGCCCTCTCTGG + Exonic
1031967193 7:128034970-128034992 AAGGCTACTTACACCCTAAGAGG + Intronic
1032680426 7:134176848-134176870 ATTCCCACACACACCCTCACAGG - Intronic
1032712650 7:134474162-134474184 AGGCCTCCTCACTCCCTCCCCGG - Intergenic
1037164371 8:15809214-15809236 CAACATCCTCACACCCTCACTGG - Intergenic
1037950833 8:23017943-23017965 AAGCCTACTCACACCCTCACTGG + Exonic
1040940076 8:52823718-52823740 AAGCACACTCACACTCACACTGG - Intergenic
1041094012 8:54331354-54331376 ATGCCTAACCTCACCCTCACAGG - Intergenic
1042176033 8:66037524-66037546 AAGCATACACACACCCTCTTGGG - Intronic
1042372168 8:68004246-68004268 AAGATTACTCCCAGCCTCACAGG + Intronic
1044613927 8:94120215-94120237 AGTCAGACTCACACCCTCACCGG + Intergenic
1044754722 8:95449250-95449272 TAGCCTACCCACCCCCTGACAGG + Intergenic
1045215884 8:100147891-100147913 AAGCCTACCCCCACACTCCCTGG + Intergenic
1045734473 8:105278953-105278975 TATCCTACTTTCACCCTCACTGG + Intronic
1046934200 8:119870734-119870756 AAGCATACACACACACACACAGG + Intergenic
1053721037 9:40946670-40946692 AAGGCAACTCAAACCATCACAGG - Intergenic
1054344952 9:63905485-63905507 AAGGCAACTCAAACCATCACAGG + Intergenic
1057917380 9:99067168-99067190 AAGCCTGCTCTCTCCCTTACTGG + Intronic
1058575348 9:106395260-106395282 CATCTTGCTCACACCCTCACAGG + Intergenic
1058943340 9:109834425-109834447 AAGCCTGCTAAGACTCTCACCGG - Intronic
1059727961 9:117027814-117027836 AATGCCAATCACACCCTCACAGG - Intronic
1062594021 9:137289400-137289422 CAGCCTCCTCAGACCCTCGCTGG - Intergenic
1202628971 M:789-811 TAGCCTAGCCACACCCCCACGGG + Intergenic
1186574652 X:10752041-10752063 AAGCTTCCTCAGGCCCTCACTGG + Intronic
1198705447 X:139443559-139443581 AAGCCTCCAGCCACCCTCACTGG + Intergenic
1201758462 Y:17514787-17514809 AAGCCAACTCTCACCCAAACAGG + Intergenic
1201843093 Y:18391203-18391225 AAGCCAACTCTCACCCAAACAGG - Intergenic