ID: 1037951918

View in Genome Browser
Species Human (GRCh38)
Location 8:23024141-23024163
Sequence CAGCAGGAATGGAGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037951918_1037951928 29 Left 1037951918 8:23024141-23024163 CCCTATTCCCTCCATTCCTGCTG 0: 1
1: 0
2: 4
3: 41
4: 487
Right 1037951928 8:23024193-23024215 GTGGGATCACCTTCATTTGCTGG 0: 1
1: 1
2: 0
3: 6
4: 81
1037951918_1037951927 11 Left 1037951918 8:23024141-23024163 CCCTATTCCCTCCATTCCTGCTG 0: 1
1: 0
2: 4
3: 41
4: 487
Right 1037951927 8:23024175-23024197 GCAAAACACTTACTCTCAGTGGG 0: 2
1: 1
2: 1
3: 9
4: 120
1037951918_1037951926 10 Left 1037951918 8:23024141-23024163 CCCTATTCCCTCCATTCCTGCTG 0: 1
1: 0
2: 4
3: 41
4: 487
Right 1037951926 8:23024174-23024196 AGCAAAACACTTACTCTCAGTGG 0: 2
1: 0
2: 1
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037951918 Original CRISPR CAGCAGGAATGGAGGGAATA GGG (reversed) Intronic
900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG + Intronic
900932793 1:5747511-5747533 CAGCAGGAAGGGAGGAAGGAGGG + Intergenic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG + Intronic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
904480743 1:30791748-30791770 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
905400731 1:37701216-37701238 GAGCAGGAAGGGAGGGAGTCAGG + Intronic
906075049 1:43045998-43046020 CTGCAGGAATGGAGAGTACAAGG - Intergenic
906231002 1:44164307-44164329 CAGCAGTAAGGAAGGGAAGATGG + Intergenic
906368160 1:45228600-45228622 CAGGAGGAATAGAGAGAATGGGG - Intronic
906474360 1:46158121-46158143 CAGCAGGAATGGGGGTGAGAAGG - Intronic
906611426 1:47206464-47206486 AAGCAGGAATGGCTGGAATGAGG - Intergenic
907096578 1:51786900-51786922 TAGTATGAATGGAGAGAATAAGG - Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907615377 1:55919157-55919179 TAGCTGGAATGGAGGAACTAGGG - Intergenic
908321952 1:62987093-62987115 CAGCAGGAACAGAGGGGAAAAGG - Intergenic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
908954780 1:69610249-69610271 CAGGAGAAAAGGAGGGAAAAAGG - Intronic
909653875 1:78007910-78007932 GAGCTGGGATGGTGGGAATAAGG + Intronic
910824749 1:91393946-91393968 CACCAGGAATGGAGAAAGTAAGG + Intronic
910870761 1:91830720-91830742 CAGGAAGAATGAAGGGCATAAGG + Intronic
912957596 1:114166385-114166407 CAGCAGAAATGGAGGGCTCAGGG - Intergenic
913448018 1:118970531-118970553 CAGCAGGAAGGCAGGTCATAAGG + Intronic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917419835 1:174851272-174851294 CACCCAGACTGGAGGGAATATGG - Intronic
917562032 1:176168479-176168501 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
917878016 1:179304647-179304669 TAGGAGGAATGGAAGGAAAAAGG - Intronic
918066788 1:181106671-181106693 CCGCAGGAAGGGAAGGAAAAAGG + Intergenic
918734170 1:188037807-188037829 CAGCTGGAATGCAGGGCACAAGG - Intergenic
919612058 1:199757803-199757825 TAGCAGGAATGGTGAGAAGAAGG - Intergenic
920067364 1:203278405-203278427 CAGCAGGAAGGGTGAGAATTTGG - Intergenic
920708813 1:208275628-208275650 GCACAGGAATGGAGGGAAGAAGG - Intergenic
923703593 1:236323892-236323914 AAGCAGTAATGGAGGAAATCAGG + Intergenic
924077377 1:240354265-240354287 GAACAGGAATGGAGAGGATAGGG + Intronic
924895925 1:248338008-248338030 CAACAGGAAAGAAGGAAATATGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1065198100 10:23286476-23286498 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1065567925 10:27033907-27033929 CAGCAAGAATGGAGTGAGTAGGG - Intronic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068257353 10:54530366-54530388 CTGCAGGAATACAGAGAATAAGG - Intronic
1069232996 10:66035512-66035534 TAGTAGGAATAGAGGGAATGAGG + Intronic
1069245016 10:66193377-66193399 CAACAGGGATGGAGGGCCTAAGG + Intronic
1069860999 10:71471717-71471739 CCGCAGGAATGGCAGGAACAAGG - Intronic
1070396220 10:76013231-76013253 CAGCAGTAAAGAAGGGATTAAGG - Intronic
1070503043 10:77089453-77089475 CCCCAGGAATGGAGAGAATTAGG - Intronic
1070729236 10:78813862-78813884 CAGCAGGGATGGAGGCAGAATGG - Intergenic
1070984208 10:80674121-80674143 CAGCAAGAATGGAGAGACTTGGG - Intergenic
1071137511 10:82469202-82469224 CGGAAGGAAGGGAGGGAAAAGGG - Intronic
1071767388 10:88683158-88683180 AAGCAGGAATGGAGGCAAGAAGG + Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073248252 10:102106663-102106685 CAGCTGGAGTGGAGGAAATACGG + Intergenic
1073637065 10:105210088-105210110 CAACAGGAATGAAGGGGAGAGGG - Intronic
1073863265 10:107771148-107771170 CAGCAGAAATGGTGGCAGTAGGG - Intergenic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1075157215 10:119988368-119988390 CAGTAGGAATAGAAGGAATGGGG + Intergenic
1075778596 10:125003213-125003235 CAGCAGGAAAGCAGGGAACAGGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076040061 10:127238910-127238932 CATGAGAAATGGAGGGGATAAGG - Intronic
1076766226 10:132635293-132635315 CAGCAGGAATGAGGGGAAAAGGG - Intronic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1078581360 11:12541900-12541922 CCCCAAGAATGGAGGGAATGGGG - Intergenic
1079321060 11:19451731-19451753 TAGCAGGAAAGAAGGGAAGAGGG + Intronic
1079665433 11:23099502-23099524 CAGCAGGAAATGGGGGAATCTGG - Intergenic
1079743453 11:24094268-24094290 CAGCAAGAAAGGCAGGAATAAGG + Intergenic
1079835738 11:25329996-25330018 GAACAGGAAAGAAGGGAATACGG + Intergenic
1079923313 11:26459133-26459155 CAGCTGGATTGGAGGGCATGAGG + Intronic
1080002080 11:27361714-27361736 CAGCATGAGTGAATGGAATATGG - Intronic
1080025341 11:27607784-27607806 GAGCTGGAAAGGAGGGAGTATGG - Intergenic
1080182890 11:29445483-29445505 CAGCAGGCAAAGAGAGAATAAGG - Intergenic
1080250662 11:30229501-30229523 AAGTAGGAATGGGGAGAATATGG - Intergenic
1080774280 11:35371283-35371305 CACTAGGAAGGGAGGGAATGTGG - Intronic
1081549175 11:44096187-44096209 CAGCAGGAAGGGAGGGGTCACGG - Exonic
1081659369 11:44878447-44878469 CAGGAGGAAAGGAAAGAATAAGG + Intronic
1083588784 11:63879958-63879980 CAGCAGCAATGCTGGGACTAGGG + Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1084421294 11:69061892-69061914 CAGAAGGAAGGCAGGGAAGATGG + Intronic
1085782485 11:79422363-79422385 CAGCAGGAAGTGAAGGAATCAGG - Intronic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086437625 11:86798102-86798124 CAGCTGGAAGGAAGGGAAGAAGG - Intronic
1087492860 11:98849897-98849919 CAGCAAGAATGTAAGGAACAGGG + Intergenic
1087779926 11:102291050-102291072 CGGCTGGAGTGGAGTGAATAAGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088478782 11:110272180-110272202 CAGCAGGAGTGAAAGGCATAGGG - Intronic
1088787027 11:113191232-113191254 GAGCAGGGTTGGAGGGAATTCGG + Intronic
1088920798 11:114258518-114258540 CACCAGGAAGGGAGGGGATTGGG + Intronic
1089378267 11:118010569-118010591 CAGCACAAATGGAGGAAATGTGG + Intergenic
1089379756 11:118019807-118019829 CAGCAGCAATGAAGGGGAAAAGG - Intergenic
1089695466 11:120213478-120213500 CATCAGCAAGGGAGGGAATTGGG + Intronic
1090115782 11:123971528-123971550 GAGCAGAAATGGATGAAATAGGG - Intergenic
1090160923 11:124494186-124494208 CACCAGGAATGGAAGGTATCTGG - Intergenic
1090231243 11:125106059-125106081 AACCAGGGAAGGAGGGAATAGGG + Intronic
1090250993 11:125251697-125251719 CAGCAGGAATGGAGGAAGAGAGG - Intronic
1090373664 11:126274313-126274335 AGGCAGGAGTGGAGGGAACAAGG + Intronic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091422816 12:357865-357887 TAGCAGGAAGGAAGGGAATTGGG - Intronic
1091679437 12:2516268-2516290 CAGCTGGAGAGGAGGGAGTAAGG + Intronic
1092140630 12:6180868-6180890 CAGCAGCAGGGGAGGGGATAGGG + Intergenic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092385285 12:8032386-8032408 CAGCTGGAATTGACGGTATACGG + Intergenic
1092971077 12:13695619-13695641 CAGAAGCAATGGAAGAAATAAGG + Intronic
1093560473 12:20533330-20533352 CAATAGGAATGGAGGAGATAGGG - Intronic
1094013158 12:25830274-25830296 CAGAAGGAAGGGAGGAAATGTGG - Intergenic
1094169117 12:27473018-27473040 CAGGAGGGAGGCAGGGAATATGG + Intronic
1094388833 12:29926558-29926580 GGGCAGGAAGGGAGGGAACAAGG + Intergenic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1096103603 12:48983971-48983993 GAACAGGAGAGGAGGGAATAGGG - Intergenic
1096268355 12:50143041-50143063 AAGGAGGGAGGGAGGGAATAAGG - Intronic
1096775048 12:53958466-53958488 CAGCTGGAATGGTGGTAATTTGG - Exonic
1097608433 12:61785098-61785120 CAGGAGGGAAGGAGGGAATAGGG - Intronic
1098009071 12:66031245-66031267 CAGCATGAGGGGAGGAAATATGG - Intergenic
1098998777 12:77151901-77151923 CAGCATGAATTGAGGAAACAAGG + Intergenic
1100590779 12:96026366-96026388 TGGCAGCAATGGTGGGAATATGG - Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1100807742 12:98305013-98305035 TAGCAGGAAGGGAGGGAGAAAGG - Intergenic
1101041875 12:100763614-100763636 CAGCAGGACTGGGGGAGATAAGG - Intronic
1101945652 12:109134400-109134422 CCCCAGGAAAGGAGGGCATACGG - Intronic
1102216249 12:111163504-111163526 CTCCAGGAATGGAGGGACAATGG - Intronic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1104386495 12:128355679-128355701 GTGGAGGAAAGGAGGGAATAAGG - Intronic
1104564203 12:129865555-129865577 GAGCAGGCATGGAGGGAATCTGG + Intronic
1105200953 13:18176686-18176708 GAGTAGGAATGGAGTGAGTAGGG - Intergenic
1105453210 13:20518544-20518566 CAGAAGCAATGGAGGGATTTTGG + Intronic
1105947629 13:25203086-25203108 CAGAAGGAAGGGAGAGAAAATGG + Intergenic
1109036177 13:57263489-57263511 AAGAAGGAAGGGAGGGAACAAGG - Intergenic
1109499151 13:63214385-63214407 AAGGAGGAATGGAGGGTGTACGG - Intergenic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1111046785 13:82824054-82824076 CAGAAGAAGTGGTGGGAATAGGG + Intergenic
1111115559 13:83772746-83772768 CAGCAGGAAGAGAGAGAATCAGG + Intergenic
1111466773 13:88623343-88623365 AAGAAGGAAGGGAGGGAGTAGGG + Intergenic
1111832138 13:93342764-93342786 CAGCAGGAAGAGAGGAAATAAGG + Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1114702034 14:24688454-24688476 CAGCAGGAAGGAAAGGAATGAGG - Intergenic
1114876891 14:26731424-26731446 CAGCAGTAATGGAGGCAGTGGGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1116213257 14:41975326-41975348 CAGCAGGAATGCAAGCAAAAGGG - Intergenic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1118513547 14:66503084-66503106 CAGCAGGCAAAGAGGGAATGAGG - Intergenic
1118701416 14:68437579-68437601 AGGCAGGAATGGAGGGAAAGGGG - Intronic
1118870356 14:69736262-69736284 CAGCAGGCAAAGAGAGAATAAGG + Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119441993 14:74634712-74634734 CACCAGGAATGCATGGAATTGGG + Intergenic
1119710262 14:76817076-76817098 GAGCAAGAAGGGAGGCAATAGGG - Intronic
1119742298 14:77021989-77022011 CAGAAGAAATGGAGGTAAAATGG + Intergenic
1120745967 14:88152176-88152198 CAGCAGGAATGGAGGAGGCAGGG + Intergenic
1121378778 14:93441730-93441752 CAGGAGGCATGGAGGGCATATGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121924388 14:97914649-97914671 CAGCAGGACTGGAGGCTATGAGG - Intergenic
1123056719 14:105574337-105574359 CACAAGGAATGAAGGGAATGGGG - Intergenic
1123081490 14:105697448-105697470 CACAAGGAATGAAGGGAATGGGG + Intergenic
1125608541 15:40956063-40956085 CAGCAGCACTGGGGGGAATCTGG - Exonic
1125793832 15:42389805-42389827 GAGCACGAATGGAGGAAAGACGG - Intronic
1126226806 15:46280321-46280343 AAGAAGGAAAGGAGGGAATGAGG + Intergenic
1126696697 15:51332285-51332307 CAGCAGGAGAGGAGAGAATCTGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127532012 15:59852595-59852617 CAGCAGGGCTGGAAGGAACATGG + Intergenic
1128496186 15:68200011-68200033 GAGAAGGAAGGGAGGGAGTAGGG - Intronic
1128607999 15:69051823-69051845 AAACAGGAATGGAAGGAAAAAGG - Intronic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1130172304 15:81527979-81528001 GAGCAGGGGTGGAGGGCATAAGG + Intergenic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1130559745 15:84948600-84948622 CTGCAGTAAGGGAGGGAATGAGG - Intergenic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1131448029 15:92515649-92515671 GAACAGGAAAGGAGGAAATATGG - Intergenic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1133839504 16:9394771-9394793 AAGCAGGAAGGGAGGGAGGAAGG - Intergenic
1135099644 16:19594807-19594829 GAAGAGGAATGGAGGGAATTAGG + Intronic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137584208 16:49654355-49654377 CACCAGGAAAGGAGGAAATGAGG - Intronic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1138390556 16:56667520-56667542 CAGCATGAATGGAGAGGACATGG - Intronic
1138391104 16:56670342-56670364 CAGCATGAATGGAGAGGAGATGG + Intronic
1139174923 16:64675281-64675303 CAGGAGGAATGCAGTGAATATGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139210033 16:65068025-65068047 AAGCAGGGAGGGAGGGAAGAAGG + Intronic
1140137552 16:72220977-72220999 CAGCAGGAAAGGAAGGGAAAGGG - Intergenic
1140467681 16:75195535-75195557 AAGCAGGAATGGATAGAATGGGG + Intergenic
1141171558 16:81694855-81694877 CCTCAGGCATGGAGGGAAAAAGG + Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1141799574 16:86297725-86297747 GAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1142030499 16:87836116-87836138 CAGGAGGAATGCAGGGAACCCGG - Intronic
1142135023 16:88447960-88447982 AAGAAGGAAGGGAGGGAAGAGGG + Intergenic
1142169625 16:88614926-88614948 CAGACGGAATGGAGGAAATGGGG - Intronic
1142500917 17:332483-332505 CATCAGGAAGGGAGGGAAGGAGG - Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142683255 17:1562384-1562406 CAGCGGGGATGGAGGGGATCCGG - Intronic
1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG + Intronic
1142781328 17:2183238-2183260 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
1143175249 17:4951389-4951411 CAGCAGGGATGGATAGAAAAGGG + Intronic
1143193473 17:5057682-5057704 CGGCAGGTAGGGAGGGCATATGG + Intergenic
1143682302 17:8486169-8486191 CAGCAGGGATACAGGGAATGGGG + Intronic
1143877263 17:10001484-10001506 CAGCAGGAATCGGGGAAAAAAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145720054 17:27062566-27062588 CATCAAGAATAGAGAGAATAGGG - Intergenic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147186485 17:38716058-38716080 CAGCACAAATGTAGGGGATAAGG - Intronic
1147490630 17:40863048-40863070 CAGCAGAAATAGAAGGAATGGGG - Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148050299 17:44766820-44766842 CACCAGGGATGGAGGGACAATGG + Intronic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1151186002 17:72364371-72364393 AAGCAGAGATGGAGGGAACACGG + Intergenic
1151500718 17:74486687-74486709 GTGCAGGAATGGTGGGAATGGGG - Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152056835 17:78035241-78035263 CAGCAAGCATGGAGGCAGTATGG + Intronic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152566683 17:81103467-81103489 CAGCAGGAAGGGAGGGGTCAGGG - Intronic
1152984323 18:308013-308035 GAACAGGCATGGAGGGAATGGGG + Intergenic
1153061119 18:996055-996077 CAGCAGAAATGAAGGGAGTAGGG + Intergenic
1153597424 18:6742023-6742045 CAGCTGGAATTGTGGGAATATGG + Intronic
1153765577 18:8371731-8371753 CAGCAGAAAGAGGGGGAATAAGG - Intronic
1156240220 18:35246751-35246773 CAGCAGGAAAGGTGGGGAAATGG + Exonic
1156538762 18:37889067-37889089 CAGAAGGAATGTAGGAAGTAGGG + Intergenic
1156897015 18:42257303-42257325 CAGCTGCCATGGAGGGACTAAGG - Intergenic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1157906551 18:51574520-51574542 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1158162355 18:54499540-54499562 GAGTAGGGATGGGGGGAATAGGG + Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159300980 18:66567293-66567315 AAGGAGGAAGAGAGGGAATAAGG + Intronic
1159773298 18:72574613-72574635 CAGCAGGAATGCAAAGTATATGG + Intronic
1160678221 19:401552-401574 CAGCAGGCAGGGAGGGTACAGGG + Intergenic
1161003728 19:1924316-1924338 CAGCAGGAATGAAGGGGAGGAGG - Exonic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1162423512 19:10579910-10579932 CGGCAGGAAAGGTGGGGATAGGG - Intronic
1162536446 19:11265291-11265313 CAGCTGGAGTGGAGTGAATGAGG - Intergenic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163687622 19:18720905-18720927 CAACAGGAAAGGAAGGACTAAGG - Intronic
1163842539 19:19620033-19620055 CAGCAGCAATGGAGAGAACGTGG - Intergenic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164618842 19:29681928-29681950 CAGCAGGCAGGGAAGGAATGGGG + Intergenic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166823985 19:45598102-45598124 CAGGAGGAAGGGAGAGACTAGGG - Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
926173714 2:10570290-10570312 GAGGAGGAAGGGAGGGAGTAGGG + Intergenic
927174185 2:20393836-20393858 CAGCAGGTATGGATGGACCATGG - Intergenic
927245521 2:20954487-20954509 CAGCAGGCAAGGAGAGAATGAGG + Intergenic
927465689 2:23334651-23334673 AAGAAGGAAGGGAAGGAATATGG + Intergenic
927505168 2:23608150-23608172 CAGCATGATGGGAGGGAAAAAGG + Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927834710 2:26385012-26385034 CAGCAAGCATGGAGAAAATAAGG - Exonic
928709938 2:33992685-33992707 TAGTAGGAATGTAGAGAATAGGG + Intergenic
929373521 2:41256002-41256024 CAGGAGGAAGGGAGGGAGTAGGG + Intergenic
929633782 2:43494330-43494352 CAGCAGGAATGAAAGAAAAAGGG - Intronic
929942935 2:46348544-46348566 CAGCAGGAAAGCAGGGGAGAGGG - Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
930953484 2:57174258-57174280 CAGCAGGCAAGCAGGGACTAGGG - Intergenic
931989522 2:67776075-67776097 CAGCACAAATGGAGGCAATGTGG + Intergenic
932484570 2:72075949-72075971 CAGCAGGAAGGTAGGGAATGGGG - Intergenic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
933658430 2:84907285-84907307 CAGCAGGAAGGGTGGGGATGTGG + Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934626095 2:95854385-95854407 GAGTAGGAATGGAGTGAGTACGG - Intronic
934807476 2:97246930-97246952 GAGTAGGAATGGAGTGAGTACGG + Intronic
934830034 2:97510257-97510279 GAGTAGGAATGGAGTGAGTACGG - Intronic
935130989 2:100260871-100260893 CCTCAGGAATGGAGGGACTTCGG - Intergenic
935750518 2:106229020-106229042 AATCAGGAATGGGGGGAACATGG - Intergenic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936990639 2:118361593-118361615 AAGCAGTATTGGAGGGAATGGGG - Intergenic
937024980 2:118690419-118690441 AAGGAGGGAGGGAGGGAATAAGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
938619077 2:133030827-133030849 CCGCTGCATTGGAGGGAATATGG - Intronic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
939209864 2:139160458-139160480 CAGCAGACATGGAAGGAACAGGG + Intergenic
940086132 2:149861198-149861220 CAGGAGGAATAGAGAGAAAAGGG + Intergenic
941142973 2:161807457-161807479 CTTCAGGGATGGAGTGAATATGG - Intronic
942592223 2:177558360-177558382 AAGTAGGAATCGAGGGAATAGGG + Intergenic
943287363 2:186019535-186019557 ACGCAGGAAGAGAGGGAATAAGG - Intergenic
943417930 2:187631383-187631405 CAGCAGGAAAAGAGAGAATGAGG - Intergenic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
944460590 2:199945569-199945591 AAGAAGGAATGAAGGGTATATGG - Intronic
946996664 2:225400333-225400355 AAGCAGGAAGGGAGGGAGTCAGG + Intergenic
948338254 2:237228336-237228358 CAGGAGAAAAGGAGGGAGTATGG + Intergenic
1169014946 20:2283965-2283987 GAAAAGGAAGGGAGGGAATAAGG + Intergenic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169226886 20:3862408-3862430 CAGCAGGTATGCATGGAATCTGG + Exonic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169833115 20:9847200-9847222 CAGAAGGAACGGAGTGAATGGGG - Intergenic
1169993064 20:11525069-11525091 CAGCTGGAGCAGAGGGAATAAGG + Intergenic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1170357363 20:15507307-15507329 AAGCAGGAAGGGAGGGAGGAAGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171150567 20:22823423-22823445 CAGCCTGAATGGAGGGACAAAGG - Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1175700619 20:61134327-61134349 CAGCAGGAAAGGAGGAAGAATGG - Intergenic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1176289977 21:5038514-5038536 CAGCTGTAAGGGAGGGAAAATGG + Intronic
1177046960 21:16182934-16182956 TAGGAGGAAGGGAGGGAAAAAGG - Intergenic
1177100481 21:16893432-16893454 AAGCAGGAATGGAGGGTGGAAGG - Intergenic
1178016817 21:28356313-28356335 CAGCAGAAATGCTGGGAATCTGG - Intergenic
1178329845 21:31678633-31678655 CAGCAGGAAGGGAGAGCAAAGGG - Intronic
1178455009 21:32741074-32741096 CAGCAAGTATGGTGGGAGTAAGG + Intronic
1178904826 21:36628158-36628180 AAGCAGGATTGGATGGGATAGGG - Intergenic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1179867275 21:44225125-44225147 CAGCTGTAAGGGAGGGAAAATGG - Intronic
1180245830 21:46546669-46546691 CATCAGGAAGGGAGGCAACATGG - Intronic
1181295007 22:21830741-21830763 CAGAAGGAATGAAGGAAATTGGG + Intronic
1181438884 22:22925505-22925527 GACCAGGAATGGAGGGGATTGGG - Intergenic
1181978173 22:26747221-26747243 CAGAAGGAATGCAGGGGTTAGGG - Intergenic
1182167236 22:28188414-28188436 GAGCAGGAATTGAGGCACTAAGG + Intronic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1183016254 22:34990141-34990163 TAGAAAGTATGGAGGGAATAAGG + Intergenic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183696605 22:39427255-39427277 CATGAGGACTGAAGGGAATAAGG - Intronic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1185122519 22:48980897-48980919 CAGCAGATCTGGAGGAAATATGG - Intergenic
949807713 3:7973947-7973969 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950913747 3:16621553-16621575 CAGGAGAAAGGGAAGGAATATGG + Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951894088 3:27594597-27594619 AAGCAGGAAAGGAGGGAGTAAGG + Intergenic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
953272656 3:41460515-41460537 CAGCAGGAATCAAGGGAGAAAGG - Intronic
953439796 3:42907447-42907469 CAGCAGGGATGGCAGGAATGGGG + Intronic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954453224 3:50582915-50582937 CAGGAGCAAGGGAGGGGATAGGG - Exonic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955603203 3:60670327-60670349 AGGCAGGAATGGAGTGAATGAGG + Intronic
956001973 3:64739269-64739291 CAGCTAGAAGGGAGGGAATCAGG - Intergenic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957041946 3:75342390-75342412 CAGCAAGATTGAAGGGAATATGG + Intergenic
957550176 3:81694239-81694261 GAGGAGGAAGGGAGGGAAAAAGG + Intronic
959310267 3:104727205-104727227 CAGCATGAATGGAATGAATTTGG - Intergenic
961036090 3:123642614-123642636 CAATAGAAATGGAGGGCATAAGG - Intronic
961046669 3:123713195-123713217 CAGCAAGAAAGAAGGGAAGATGG + Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
962003981 3:131329825-131329847 CAGCCGGAATGGAGGGAGTGAGG + Intronic
963273891 3:143311583-143311605 CAGCAGTAATGGGGAGAATTAGG + Intronic
964252559 3:154735471-154735493 CATTAGAAATGGAAGGAATAAGG + Intergenic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965703338 3:171480932-171480954 CATCAGGAAGGGAAGGAAAAGGG - Intergenic
966415677 3:179687314-179687336 CAGCAGGAATGGAGAAGACAGGG - Intronic
966803662 3:183788282-183788304 CAGCAGGGAGGGAGGGAGTGGGG - Intronic
967278005 3:187795401-187795423 AAGAAGGAAGGGAGGGAAGATGG + Intergenic
967289834 3:187908629-187908651 CTGCAGGAGTGCAGAGAATATGG - Intergenic
967639827 3:191848610-191848632 AAGAAGGAAGGGAGGGATTAAGG + Intergenic
967815818 3:193797356-193797378 CAGCAAGAATGGAGAGGAGATGG + Intergenic
967988873 3:195116517-195116539 CAGCAAGAAGGGAGGGAACTTGG + Intronic
969345497 4:6567344-6567366 TAGCTGGAATGGAGGGAACCAGG - Intergenic
969494632 4:7519648-7519670 CAGCAGCAATGAAGGGATGAGGG - Intronic
970068357 4:12125402-12125424 CAGCAAGAATGAAGGAAGTAAGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971028747 4:22613786-22613808 CACAGGGAAAGGAGGGAATATGG + Intergenic
972169577 4:36328806-36328828 CAGTAGGAAAATAGGGAATAGGG - Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975397907 4:73898901-73898923 CAGCAGGAAGGAAAGGAAGATGG + Intergenic
976151893 4:82100710-82100732 CAGGATGATTGGTGGGAATAAGG - Intergenic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
979171116 4:117601879-117601901 GAACAGGAAAGGAGGAAATATGG + Intergenic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
982520156 4:156406543-156406565 TGGCAGGGATGGAGGGAAAAGGG + Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985201180 4:187487015-187487037 AAGCAGTAAGGAAGGGAATATGG - Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
987780494 5:22427742-22427764 AAGCAGGAATGGAGGAGAGAAGG + Intronic
987885077 5:23802084-23802106 TAGCAGGCATGGAGTGAATTGGG + Intergenic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
990462231 5:56039926-56039948 GAGCAGAAAGGGTGGGAATATGG - Intergenic
991402539 5:66268681-66268703 CAGCAGTAATTGAGGAATTAAGG - Intergenic
991592011 5:68261883-68261905 CAGCAGAAAGGGAAGGGATAGGG - Intronic
992434582 5:76743120-76743142 CAGAAGGAATGGAGGAAATAAGG + Intergenic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992924332 5:81566431-81566453 CAGCAGGCAAAGAGAGAATAAGG - Intronic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994093116 5:95825919-95825941 GAGCAGGTATGGAGGAAAGAGGG - Intergenic
995190596 5:109315708-109315730 CATCAGGAATGGAGGGACTCAGG + Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
996470636 5:123856077-123856099 CTGGAAGAATGGTGGGAATAAGG - Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
996715459 5:126584326-126584348 CAGCAAGATTGGAGGGGAAATGG + Intronic
996898443 5:128514961-128514983 GACCAGGAATATAGGGAATATGG - Intronic
997046551 5:130325867-130325889 CAGCAGCAATGGAGGAAATGAGG + Intergenic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
997835077 5:137185640-137185662 CAGAAGGAATGCAGAGAACATGG + Intronic
997840834 5:137237793-137237815 CAGCAGGAACTCAGGGAATGAGG - Intronic
998216728 5:140243159-140243181 CAGCAGCAATGGCAGGAACACGG + Intronic
999762669 5:154714650-154714672 CTGCAGGAAAGGAGAGAACAGGG - Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1002066452 5:176654417-176654439 CAGCCGGCATGGAGGAAATGGGG + Intronic
1003706352 6:8535589-8535611 CAACAGGAAATGAGGGAAGAAGG - Intergenic
1003907353 6:10714266-10714288 CAGAAGGAAAGAAGGAAATAAGG - Intergenic
1004206483 6:13596172-13596194 TATCAGGAGTGGAGGGATTATGG + Intronic
1005821785 6:29604802-29604824 AAGGAGGGATGGAGGGAACATGG + Intronic
1006672829 6:35740279-35740301 CAGCAGGAAAGCAGGGAGGATGG - Intronic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1008664845 6:53706003-53706025 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1010021395 6:71163858-71163880 CTGGAGGAATGGAGTGAGTATGG - Intergenic
1011237890 6:85237807-85237829 AAGCAGTAAGGGAGGGAAAAGGG + Intergenic
1011642018 6:89424608-89424630 CAGCAGGCAAGGAGAGAATGAGG + Intergenic
1012020113 6:93907441-93907463 CAGCAGGAAAAGAGAGAATGAGG - Intergenic
1012604066 6:101134867-101134889 TAGTAGGAATGGTAGGAATAAGG - Intergenic
1014431687 6:121378422-121378444 CAGTAGGAAAGGAAGGAATAGGG - Intergenic
1014555697 6:122841098-122841120 GAGGAGGAATGGAGGGTAGAAGG - Intergenic
1014788004 6:125639944-125639966 CAGCAGCAATGGAAGGACTTTGG + Intergenic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1015068923 6:129065898-129065920 CAGCAGGCAAGGAGAGAATGAGG - Intronic
1015217566 6:130767696-130767718 CAGCAGCAATGGATGCAAAAGGG - Intergenic
1015699134 6:136015709-136015731 CACCAAGAATGGAAGGAATCCGG - Intronic
1016402335 6:143694096-143694118 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1017758649 6:157551207-157551229 CAGGAGGAAGGGAGGGGACACGG - Intronic
1019189125 6:170240011-170240033 CAGCAAGCATGCAGGGAACAAGG - Intergenic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1021234882 7:18130651-18130673 CATCGGGAATGGAGGGATTTAGG - Intronic
1022869429 7:34460343-34460365 CAGCAGAACTGAAGGAAATAGGG + Intergenic
1023528294 7:41128094-41128116 CAGGAGGAAAGGAGAGAACAGGG + Intergenic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1023870347 7:44260045-44260067 CTTGAGGACTGGAGGGAATAAGG - Intronic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1026127011 7:67587898-67587920 CAGCAGGAAGGAAGGAAAGAGGG - Intergenic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028064194 7:86361063-86361085 CATCAGGGAAGGAGGGAACAAGG + Intergenic
1028117298 7:87013551-87013573 CAGCAGGGATGGAGTGAGGAAGG + Intronic
1029488389 7:100856994-100857016 CAGCAGGAATGTGAGGAATGAGG - Exonic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029924474 7:104301159-104301181 CAGGAGCAATGGATGGAACATGG + Intergenic
1029984620 7:104911711-104911733 CAGGAGAAATAGAGAGAATAAGG + Intergenic
1031057439 7:117008643-117008665 CATCAGAAATGAAGGGAATTGGG + Intronic
1031448103 7:121879824-121879846 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1031856125 7:126924622-126924644 CAGAAGGAAGGGAGGAAAGAAGG - Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034848953 7:154475759-154475781 CAACAGCAATGGAGGCAACAGGG - Intronic
1035095761 7:156353686-156353708 CGCAAGGAATGGAGGGAACAGGG - Intergenic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1036472082 8:9061216-9061238 GAGCAGGAAGGAAGGAAATATGG + Intronic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1037958860 8:23081081-23081103 TAGAAGGAATGGAGGCAATAGGG + Intergenic
1037966501 8:23138141-23138163 CAGCAGGAGGACAGGGAATAGGG - Intronic
1037974069 8:23197085-23197107 CAGCAGAAATGGTGGGAATAGGG - Intronic
1038232486 8:25715006-25715028 CAACAGGAATGAAGGAAATAAGG - Intergenic
1038464752 8:27751209-27751231 CAGCAGCAATGGAAGGGATAAGG + Intronic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041435483 8:57835724-57835746 AAGTAGTAATGGAGGAAATAGGG - Intergenic
1041840433 8:62264262-62264284 CACCAGGAATGGAGAAAACAGGG - Intronic
1043389636 8:79779855-79779877 CTTCAGGAATGGAAAGAATAAGG + Intergenic
1043599137 8:81917594-81917616 GAACAGGAAAGGAGGAAATATGG - Intergenic
1043718042 8:83509580-83509602 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1044775231 8:95679794-95679816 CAGCAAGAAGGGATGGAATAGGG - Intergenic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045526949 8:102949090-102949112 CAGCTGGAAAGGAGGGAATGTGG - Intronic
1045542436 8:103099710-103099732 CAGCAGGGATGAAGGGAGAAAGG - Intergenic
1045544655 8:103117862-103117884 CAGCAGAAAAGCAGTGAATATGG - Intergenic
1045747492 8:105440757-105440779 CATCAAGAAGGAAGGGAATAAGG + Intronic
1046605349 8:116365535-116365557 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1047362956 8:124185549-124185571 GAGCAGGGATGGAGGAAACAGGG + Intergenic
1047915159 8:129575148-129575170 CAGTTGGAAAGAAGGGAATAAGG + Intergenic
1048440869 8:134458240-134458262 CAGGAGGAATGGGGAGAATTAGG + Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049867508 8:144948374-144948396 CAGCAGAAATGGAGGAGACATGG + Intronic
1050078523 9:1890305-1890327 CAACAGGAATGCCTGGAATAGGG + Intergenic
1050368214 9:4892877-4892899 CAGCAAGAATGGAGGAAAAGAGG + Intergenic
1051870427 9:21731061-21731083 ATGCAGGAATGGAGAGAAAATGG - Intergenic
1053103964 9:35394700-35394722 CAGGAGGAAAGGAGGGAGTTAGG + Intronic
1053140554 9:35680098-35680120 CAGCTGGACTGGAGAGAAAAAGG - Exonic
1053183551 9:35994827-35994849 CTTCTGGAAGGGAGGGAATAAGG - Intergenic
1054941149 9:70743617-70743639 CAACTGGAATGGAGAGACTAGGG + Intronic
1056547025 9:87621429-87621451 CTACAGGAATGGAGGAAATCTGG - Intronic
1057164911 9:92917770-92917792 CTGCAGGAGGGAAGGGAATAAGG - Intergenic
1057255961 9:93547306-93547328 TAACAGGGATGGAGGGCATAAGG + Intronic
1059217120 9:112574615-112574637 GAGCTTGAATGGAGGGAAGATGG - Exonic
1059243886 9:112833194-112833216 CAGCTGGAAGAGGGGGAATAGGG - Intronic
1059255372 9:112925573-112925595 CCCCAGGAAGGGAGGGAAAATGG + Intergenic
1059541778 9:115137432-115137454 TTGCAGGGATGGAGGGAATTGGG + Intergenic
1059955504 9:119511617-119511639 CAGCAGGAAAGGAGGCGAGAAGG - Intronic
1060124132 9:121025213-121025235 CAGTAGAAGTGGAGGTAATAGGG + Intronic
1061296422 9:129679279-129679301 CACAAGGAATGGAGGGAGTCCGG + Intronic
1061369124 9:130187956-130187978 AAGCAGGAATGTGGGGACTAGGG + Intronic
1062254209 9:135613497-135613519 CAGCAGGGAGGGAGGGAGTGGGG + Intergenic
1203583401 Un_KI270746v1:37255-37277 GAGTAGGAATGGAGTGAGTAGGG + Intergenic
1185939341 X:4297989-4298011 CAGAAAGAATGAAGGGAAAAAGG - Intergenic
1187931465 X:24297231-24297253 CAGCAGATATGTAGGGAATTAGG - Intergenic
1190396685 X:49992273-49992295 AAGCAGTAATGGTGGGAAAATGG - Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192207814 X:69107702-69107724 AAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1195406955 X:104525003-104525025 CATCAGGAAGGCAGGGAATTGGG + Intergenic
1195505624 X:105653498-105653520 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1195830366 X:109051101-109051123 CAGCATGAATTGTGGGATTATGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1196226954 X:113178570-113178592 GAACAGGAAAGGAGGAAATATGG + Intergenic
1196278419 X:113795729-113795751 CAGCAGGCAAAGAGAGAATAAGG - Intergenic
1196300277 X:114044127-114044149 GAACAGGAAAGGAGGAAATATGG - Intergenic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1197254482 X:124247832-124247854 AAGCAGCAATGGAGGGATTGAGG - Intronic
1197721543 X:129748011-129748033 GAGCAGGAAGGGAGGAAAGAAGG + Intronic
1197870473 X:131058541-131058563 CAGCAGGAAGGGAGGCAAGGGGG - Intronic
1198134076 X:133729282-133729304 GAGGAATAATGGAGGGAATAGGG - Intronic
1199839664 X:151631830-151631852 CATAAGGAATGGAGTCAATACGG - Intronic
1199843058 X:151670388-151670410 TAGCTGGAATAGAAGGAATAAGG - Intronic
1201370697 Y:13260326-13260348 CAGCAGGAAAAGAGGTTATATGG - Exonic