ID: 1037953618

View in Genome Browser
Species Human (GRCh38)
Location 8:23036110-23036132
Sequence AACAGCTCTTGGCTTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037953614_1037953618 11 Left 1037953614 8:23036076-23036098 CCATCCTCTGCAGATAACTACTC 0: 7
1: 198
2: 208
3: 121
4: 258
Right 1037953618 8:23036110-23036132 AACAGCTCTTGGCTTGTTTCTGG No data
1037953615_1037953618 7 Left 1037953615 8:23036080-23036102 CCTCTGCAGATAACTACTCTCCT 0: 5
1: 11
2: 22
3: 42
4: 203
Right 1037953618 8:23036110-23036132 AACAGCTCTTGGCTTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037953618 Original CRISPR AACAGCTCTTGGCTTGTTTC TGG Intronic
No off target data available for this crispr