ID: 1037956993

View in Genome Browser
Species Human (GRCh38)
Location 8:23068094-23068116
Sequence GGAAAACGAGATTTAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037956993_1037956996 -3 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC No data
Right 1037956996 8:23068114-23068136 TCCCAAGGAACCCCAAACAATGG No data
1037956993_1037957004 28 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037956993_1037957006 30 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC No data
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037956993_1037957005 29 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC No data
Right 1037957005 8:23068146-23068168 TGAGCGGCCCCGCACGCGTAGGG No data
1037956993_1037957003 13 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC No data
Right 1037957003 8:23068130-23068152 ACAATGGCATTGGCGATGAGCGG No data
1037956993_1037956999 3 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC No data
Right 1037956999 8:23068120-23068142 GGAACCCCAAACAATGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037956993 Original CRISPR GGAAAACGAGATTTAGGAGA AGG (reversed) Intronic