ID: 1037956997

View in Genome Browser
Species Human (GRCh38)
Location 8:23068115-23068137
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037956997_1037957003 -8 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957003 8:23068130-23068152 ACAATGGCATTGGCGATGAGCGG No data
1037956997_1037957011 26 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957011 8:23068164-23068186 TAGGGGCGCAGCCGCTAAGGAGG No data
1037956997_1037957004 7 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037956997_1037957005 8 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957005 8:23068146-23068168 TGAGCGGCCCCGCACGCGTAGGG No data
1037956997_1037957013 28 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957013 8:23068166-23068188 GGGGCGCAGCCGCTAAGGAGGGG No data
1037956997_1037957010 23 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957010 8:23068161-23068183 GCGTAGGGGCGCAGCCGCTAAGG No data
1037956997_1037957012 27 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957012 8:23068165-23068187 AGGGGCGCAGCCGCTAAGGAGGG No data
1037956997_1037957006 9 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037956997 Original CRISPR GCCATTGTTTGGGGTTCCTT GGG (reversed) Intronic