ID: 1037957001

View in Genome Browser
Species Human (GRCh38)
Location 8:23068125-23068147
Sequence CATCGCCAATGCCATTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037957001_1037957013 18 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957013 8:23068166-23068188 GGGGCGCAGCCGCTAAGGAGGGG No data
1037957001_1037957016 24 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957016 8:23068172-23068194 CAGCCGCTAAGGAGGGGAAGGGG No data
1037957001_1037957004 -3 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037957001_1037957014 22 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957014 8:23068170-23068192 CGCAGCCGCTAAGGAGGGGAAGG No data
1037957001_1037957015 23 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957015 8:23068171-23068193 GCAGCCGCTAAGGAGGGGAAGGG No data
1037957001_1037957005 -2 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957005 8:23068146-23068168 TGAGCGGCCCCGCACGCGTAGGG No data
1037957001_1037957010 13 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957010 8:23068161-23068183 GCGTAGGGGCGCAGCCGCTAAGG No data
1037957001_1037957006 -1 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037957001_1037957012 17 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957012 8:23068165-23068187 AGGGGCGCAGCCGCTAAGGAGGG No data
1037957001_1037957011 16 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957011 8:23068164-23068186 TAGGGGCGCAGCCGCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037957001 Original CRISPR CATCGCCAATGCCATTGTTT GGG (reversed) Intronic