ID: 1037957004

View in Genome Browser
Species Human (GRCh38)
Location 8:23068145-23068167
Sequence ATGAGCGGCCCCGCACGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037956995_1037957004 22 Left 1037956995 8:23068100-23068122 CCTAAATCTCGTTTTCCCAAGGA No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037957002_1037957004 -4 Left 1037957002 8:23068126-23068148 CCAAACAATGGCATTGGCGATGA No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037956992_1037957004 29 Left 1037956992 8:23068093-23068115 CCCTTCTCCTAAATCTCGTTTTC No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037956998_1037957004 6 Left 1037956998 8:23068116-23068138 CCAAGGAACCCCAAACAATGGCA No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037957000_1037957004 -2 Left 1037957000 8:23068124-23068146 CCCCAAACAATGGCATTGGCGAT No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037957001_1037957004 -3 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037956993_1037957004 28 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data
1037956997_1037957004 7 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957004 8:23068145-23068167 ATGAGCGGCCCCGCACGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037957004 Original CRISPR ATGAGCGGCCCCGCACGCGT AGG Intronic