ID: 1037957006

View in Genome Browser
Species Human (GRCh38)
Location 8:23068147-23068169
Sequence GAGCGGCCCCGCACGCGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037956993_1037957006 30 Left 1037956993 8:23068094-23068116 CCTTCTCCTAAATCTCGTTTTCC 0: 1
1: 0
2: 1
3: 16
4: 269
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037956998_1037957006 8 Left 1037956998 8:23068116-23068138 CCAAGGAACCCCAAACAATGGCA 0: 1
1: 0
2: 0
3: 20
4: 281
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037957002_1037957006 -2 Left 1037957002 8:23068126-23068148 CCAAACAATGGCATTGGCGATGA 0: 1
1: 0
2: 2
3: 6
4: 78
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037956995_1037957006 24 Left 1037956995 8:23068100-23068122 CCTAAATCTCGTTTTCCCAAGGA 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037957001_1037957006 -1 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037956997_1037957006 9 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data
1037957000_1037957006 0 Left 1037957000 8:23068124-23068146 CCCCAAACAATGGCATTGGCGAT 0: 1
1: 0
2: 11
3: 239
4: 484
Right 1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037957006 Original CRISPR GAGCGGCCCCGCACGCGTAG GGG Intronic
No off target data available for this crispr