ID: 1037957011

View in Genome Browser
Species Human (GRCh38)
Location 8:23068164-23068186
Sequence TAGGGGCGCAGCCGCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037957002_1037957011 15 Left 1037957002 8:23068126-23068148 CCAAACAATGGCATTGGCGATGA No data
Right 1037957011 8:23068164-23068186 TAGGGGCGCAGCCGCTAAGGAGG No data
1037957001_1037957011 16 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957011 8:23068164-23068186 TAGGGGCGCAGCCGCTAAGGAGG No data
1037957000_1037957011 17 Left 1037957000 8:23068124-23068146 CCCCAAACAATGGCATTGGCGAT No data
Right 1037957011 8:23068164-23068186 TAGGGGCGCAGCCGCTAAGGAGG No data
1037956998_1037957011 25 Left 1037956998 8:23068116-23068138 CCAAGGAACCCCAAACAATGGCA No data
Right 1037957011 8:23068164-23068186 TAGGGGCGCAGCCGCTAAGGAGG No data
1037956997_1037957011 26 Left 1037956997 8:23068115-23068137 CCCAAGGAACCCCAAACAATGGC No data
Right 1037957011 8:23068164-23068186 TAGGGGCGCAGCCGCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037957011 Original CRISPR TAGGGGCGCAGCCGCTAAGG AGG Intronic