ID: 1037957016

View in Genome Browser
Species Human (GRCh38)
Location 8:23068172-23068194
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037957000_1037957016 25 Left 1037957000 8:23068124-23068146 CCCCAAACAATGGCATTGGCGAT No data
Right 1037957016 8:23068172-23068194 CAGCCGCTAAGGAGGGGAAGGGG No data
1037957002_1037957016 23 Left 1037957002 8:23068126-23068148 CCAAACAATGGCATTGGCGATGA No data
Right 1037957016 8:23068172-23068194 CAGCCGCTAAGGAGGGGAAGGGG No data
1037957007_1037957016 -4 Left 1037957007 8:23068153-23068175 CCCCGCACGCGTAGGGGCGCAGC No data
Right 1037957016 8:23068172-23068194 CAGCCGCTAAGGAGGGGAAGGGG No data
1037957009_1037957016 -6 Left 1037957009 8:23068155-23068177 CCGCACGCGTAGGGGCGCAGCCG No data
Right 1037957016 8:23068172-23068194 CAGCCGCTAAGGAGGGGAAGGGG No data
1037957008_1037957016 -5 Left 1037957008 8:23068154-23068176 CCCGCACGCGTAGGGGCGCAGCC No data
Right 1037957016 8:23068172-23068194 CAGCCGCTAAGGAGGGGAAGGGG No data
1037957001_1037957016 24 Left 1037957001 8:23068125-23068147 CCCAAACAATGGCATTGGCGATG No data
Right 1037957016 8:23068172-23068194 CAGCCGCTAAGGAGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type