ID: 1037957167

View in Genome Browser
Species Human (GRCh38)
Location 8:23068839-23068861
Sequence TCGGGGGCCCGGAAAAGGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037957167_1037957184 20 Left 1037957167 8:23068839-23068861 CCGTGCCTTTTCCGGGCCCCCGA 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1037957184 8:23068882-23068904 CCCGTTGTTCCATGGCGGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1037957167_1037957180 15 Left 1037957167 8:23068839-23068861 CCGTGCCTTTTCCGGGCCCCCGA 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1037957180 8:23068877-23068899 CTGTCCCCGTTGTTCCATGGCGG 0: 1
1: 0
2: 0
3: 4
4: 69
1037957167_1037957179 12 Left 1037957167 8:23068839-23068861 CCGTGCCTTTTCCGGGCCCCCGA 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1037957179 8:23068874-23068896 GTTCTGTCCCCGTTGTTCCATGG 0: 1
1: 0
2: 0
3: 1
4: 72
1037957167_1037957182 19 Left 1037957167 8:23068839-23068861 CCGTGCCTTTTCCGGGCCCCCGA 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1037957182 8:23068881-23068903 CCCCGTTGTTCCATGGCGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037957167 Original CRISPR TCGGGGGCCCGGAAAAGGCA CGG (reversed) Exonic
900319139 1:2073950-2073972 CCGGGGGCGCGGAAAATCCACGG - Intronic
900540074 1:3198165-3198187 TCGGGGGTCCAGAGAACGCATGG - Intronic
901629908 1:10642992-10643014 TGGGGGGCCCTGAAAGGACACGG + Exonic
901906458 1:12416217-12416239 TGGGGGGCCTGAAGAAGGCATGG - Intronic
902570275 1:17342527-17342549 TTGGGGGCTCTAAAAAGGCAGGG + Intronic
903192055 1:21662442-21662464 TAGGGGGCCAGGAGAAGTCAGGG + Intronic
903703429 1:25267565-25267587 GCGGGGGGCGGGAACAGGCACGG + Intronic
903712696 1:25337894-25337916 GCGGGGGGCGGGAACAGGCACGG + Intronic
910935790 1:92484042-92484064 TCGAGGACCCGGAAGGGGCAAGG + Intronic
915080690 1:153349773-153349795 TGGGCGGCCAGCAAAAGGCATGG - Intergenic
915471713 1:156129740-156129762 TCAGGGGCCCAGAAAAGGTGAGG + Intronic
915630899 1:157153702-157153724 TCAGAGCCCCGGCAAAGGCAGGG + Intergenic
917980288 1:180265005-180265027 ATGGGGGCCCGGAATAGGCATGG - Intronic
920793013 1:209110598-209110620 TGGTGCCCCCGGAAAAGGCATGG + Intergenic
922423581 1:225475056-225475078 TGAGAGGCCGGGAAAAGGCAAGG + Intergenic
1062893518 10:1084833-1084855 ACGGGGACCTGGAAAAGACAGGG - Intronic
1064627479 10:17275948-17275970 TAGGTGGCCTGGAAAAGGTAAGG - Intergenic
1068805323 10:61188687-61188709 TTTGGAGCCAGGAAAAGGCAAGG + Intergenic
1071532502 10:86400721-86400743 TCGGGGACCCGGATATGGAAGGG - Intergenic
1073302975 10:102482147-102482169 TCAGGGGCCCGGAATCGGGAAGG + Exonic
1074814099 10:117131878-117131900 TCATGGGCCCAGAATAGGCAAGG - Intronic
1076622909 10:131804206-131804228 TCGGGGGCCTGGAAATGCTAAGG - Intergenic
1081368827 11:42272869-42272891 GCTGGGGCCAGGAAAACGCATGG + Intergenic
1081576490 11:44321733-44321755 CCGGGAGCCGGGAAAAGGAAAGG - Intergenic
1083322846 11:61857758-61857780 TCGGGGGCTCTGCAAAAGCAGGG - Intronic
1083589809 11:63887015-63887037 TGGGGGGCTGGGAAAAGGAAGGG + Intronic
1083664950 11:64269276-64269298 CCGAGGGCCCGGAATCGGCAGGG - Intergenic
1083876149 11:65525305-65525327 TCGGCGGCGCGGAATAGGCAAGG - Intronic
1084571161 11:69960780-69960802 TGGGGGGACAGGAACAGGCAAGG - Intergenic
1085395080 11:76203103-76203125 ACTGAGGCCCGGAAAGGGCAGGG + Intronic
1088724133 11:112619605-112619627 TAGGAGGCCCAGCAAAGGCAGGG + Intergenic
1091758509 12:3071912-3071934 TTGGGGGCCCGGACGTGGCAGGG + Intergenic
1092791683 12:12076108-12076130 TGGGATGCCCGGAAAATGCATGG + Intronic
1092791694 12:12076138-12076160 TGGGATGCCCGGAAAATGCATGG + Intronic
1092791705 12:12076168-12076190 TGGGATGCCCGGAAAATGCATGG + Intronic
1092791716 12:12076198-12076220 TGGGATGCCCGGAAAATGCATGG + Intronic
1095734657 12:45543392-45543414 TTGGGGGCCCTGAGAAGCCAAGG + Intergenic
1096010007 12:48204971-48204993 TTGGGGGCCCAGAAAGGGAAGGG + Intergenic
1096127578 12:49131098-49131120 GCGGGGGCCCGGAAAGGTCGAGG - Intronic
1097041472 12:56158464-56158486 TGGGGGGCGAGGAGAAGGCAGGG + Intronic
1099713765 12:86264630-86264652 TTGGGGGCCAGGGACAGGCAGGG + Intronic
1102240962 12:111324429-111324451 GAGGGGGCCAGGAAGAGGCAGGG + Intronic
1106249322 13:27971858-27971880 GCTGGGTCCCTGAAAAGGCAGGG + Intergenic
1111612485 13:90621821-90621843 TCTGGAGCCTGGAAAAGGCCAGG + Intergenic
1111672550 13:91348314-91348336 CCCGGGCCCCGGAGAAGGCACGG - Intergenic
1115093096 14:29602248-29602270 TCGGGGGCCCAGGGAGGGCAGGG + Intronic
1119962630 14:78877341-78877363 ACGGGGCCCTGAAAAAGGCATGG - Intronic
1122120273 14:99549537-99549559 TCTGGGGCCTGGGAAAGGGAAGG - Intronic
1122306114 14:100767878-100767900 TTGGGTGCCCTGCAAAGGCAGGG + Intergenic
1127313871 15:57776651-57776673 TTGGGGGCAGGGAAAAGGCTTGG + Intronic
1128472624 15:67968014-67968036 CAGGGGGCCAGGAACAGGCAGGG - Intergenic
1128675061 15:69602531-69602553 TTGGGGGCCCTGAGAAGGCCTGG - Intergenic
1131997130 15:98143742-98143764 TGTGGGGCCCAGAAAAGGAAGGG - Intergenic
1132803050 16:1763526-1763548 CCGGTGGCCGGGAAAAGGCGAGG + Intronic
1133089182 16:3390221-3390243 TCAGGGGCAAGGCAAAGGCAGGG + Intronic
1133995367 16:10744102-10744124 GCGCAGGCCCGGAAAAGGCGGGG + Intronic
1134195530 16:12156516-12156538 TCTGGGGGCAGGAAGAGGCAAGG - Intronic
1134251693 16:12578603-12578625 TCGGGAAACCAGAAAAGGCAGGG + Intergenic
1139663089 16:68435570-68435592 GCTGGGGCCTGGGAAAGGCACGG + Intronic
1141047964 16:80734245-80734267 TTGGGGGCCGGGGAAAGGCAAGG + Intronic
1141097297 16:81171903-81171925 TCTAGAACCCGGAAAAGGCAAGG + Intergenic
1142198781 16:88751185-88751207 CCAGGGGCACGGAAAACGCAGGG + Intronic
1142200907 16:88760724-88760746 CAGGGGGCCCGGGACAGGCAGGG + Intronic
1142361795 16:89630892-89630914 GCAGGGGCCAGGAAAGGGCAAGG - Intronic
1146929146 17:36765620-36765642 TCGTGGGCCAGGAAGAGGGAGGG - Intergenic
1147307449 17:39573784-39573806 TGGGGGCCCCGGACAAGGAAGGG + Intergenic
1147321676 17:39650341-39650363 TCAGGAGCCAGGAAGAGGCAAGG + Intronic
1148759375 17:49991540-49991562 GCGGGGGCCCGGGAGAGGCATGG + Exonic
1149063299 17:52450133-52450155 TCTGGGAGCTGGAAAAGGCAAGG - Intergenic
1159014905 18:63093366-63093388 CCGGGAGCCAGGAAGAGGCAAGG - Intergenic
1161399893 19:4062603-4062625 CCGGGGGCCAGGAAAGGGGATGG - Intronic
1161730696 19:5958947-5958969 TCGGGGGGCCTGCGAAGGCAGGG - Intronic
1167970087 19:53183812-53183834 TGGGGACCCCGGAAAAGGAAAGG + Intronic
1168719138 19:58545191-58545213 ATGGGGGCCCGGACAGGGCACGG + Intronic
926192502 2:10739345-10739367 TCGAGGGCACAGAAAAGCCATGG - Intronic
927244868 2:20949524-20949546 TCGGGGGTCCAGAAAGGGAAGGG + Intergenic
929468769 2:42169901-42169923 TCGGGGGGCCTGAGAAGGAAGGG - Intronic
936171974 2:110184832-110184854 TCAGGGGCCCGGAATTGGGAAGG - Intronic
937046583 2:118855093-118855115 TAGGGGGCTCGGTAAAGGGAAGG + Intergenic
938575330 2:132598054-132598076 TCGGGGCCACAGAAAATGCAGGG + Intronic
945383549 2:209169546-209169568 TCTAGGGTCTGGAAAAGGCAAGG + Intergenic
1173203153 20:40968949-40968971 TCGGCGGCCCGTAAAAGAGATGG - Intergenic
1177757194 21:25362028-25362050 TGGGGGGCCCGGAAGTGGTAGGG - Intergenic
1179725624 21:43339895-43339917 TCGGGAAGCAGGAAAAGGCAGGG + Intergenic
1184074231 22:42165950-42165972 TTGGGTGCCCTGACAAGGCAGGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185418538 22:50722464-50722486 ACGGGGCCACGGACAAGGCACGG - Intergenic
950196171 3:11010885-11010907 TGGGGAGCCCTGAAAAGCCAGGG - Intronic
950540336 3:13608675-13608697 TCCTGGGCCTGGAAAAGGGAAGG - Intronic
955400021 3:58585081-58585103 GCGGGGCCTCGGAAAAGGGACGG - Intronic
957180841 3:76875554-76875576 TCTGGAGGCTGGAAAAGGCAAGG - Intronic
959134141 3:102395500-102395522 TCTGGGGGCTGGAAAAGGCAAGG + Intronic
959863778 3:111243297-111243319 TGGGGGGCCAGGAGCAGGCAGGG - Intronic
962873768 3:139520000-139520022 ACAGGGGCCCTGAAAAGGGAAGG - Intronic
969511564 4:7620907-7620929 TCGGGGGCCTGGAATACTCAGGG - Intronic
969671718 4:8593431-8593453 TCTGGGGCCCGGAGAGGGAATGG + Intronic
969674615 4:8607933-8607955 ACTGAGGCCCGGAAAAGGGAGGG - Intronic
969967542 4:11012822-11012844 TAGGGGGCATGGGAAAGGCAGGG + Intergenic
985268366 4:188171340-188171362 TCTAGCGGCCGGAAAAGGCATGG + Intergenic
985989091 5:3540222-3540244 TGGGGGGCACGGAAAGGGAAGGG + Intergenic
987733272 5:21805392-21805414 TCAGGGGTCCTTAAAAGGCATGG - Intronic
997389229 5:133499992-133500014 TCATGGGCCAGGAAAAGGCTGGG + Intronic
999265344 5:150263779-150263801 TTGGGGGCCCAGAATAGGCAGGG + Intronic
1001405597 5:171474832-171474854 TGGGGGGCACGGAAAAAGGATGG - Intergenic
1005327391 6:24716078-24716100 TCGGGGGGCGGGGAAATGCAAGG + Intronic
1006620664 6:35361665-35361687 CCTGGGCCCTGGAAAAGGCAGGG + Intronic
1007934542 6:45721347-45721369 TCTGGGAGCTGGAAAAGGCAGGG + Intergenic
1019352536 7:561760-561782 TCTGGGGCCCGGCAAAGGCACGG + Intronic
1022494528 7:30844578-30844600 TCGGGGGCCTGGAGAAGAGAAGG + Intronic
1024791017 7:52964859-52964881 TCTCGGGGCTGGAAAAGGCAAGG + Intergenic
1025942024 7:66081927-66081949 GCAGGGGCCTGGAGAAGGCAGGG + Exonic
1030227547 7:107169413-107169435 GCGGGGGCCGGGAGGAGGCAGGG + Intronic
1032466969 7:132152168-132152190 GCAGGGGCCAGGAAAAGCCAAGG + Intronic
1037957167 8:23068839-23068861 TCGGGGGCCCGGAAAAGGCACGG - Exonic
1037991008 8:23321224-23321246 TCTGGGGCCAGGAAAACACATGG + Intronic
1038266211 8:26041522-26041544 ACGGAGACCCGGAAAGGGCAAGG + Intronic
1041417666 8:57630129-57630151 TCTGGGATCTGGAAAAGGCAAGG + Intergenic
1043512261 8:80961136-80961158 TAGGGGGCACAGTAAAGGCAGGG + Intergenic
1049606443 8:143531421-143531443 TCGGAGGGCCGGGAGAGGCAGGG + Intronic
1056896212 9:90553128-90553150 TCCAGGGGCTGGAAAAGGCAAGG - Intergenic
1061899165 9:133664222-133664244 TCTGGGGTCCGGCAAAGCCAAGG + Intronic
1186768553 X:12795030-12795052 TCTGGAAACCGGAAAAGGCACGG - Intronic
1192196490 X:69032156-69032178 TCTGGGGCCCAGAGAAGGGAAGG - Intergenic
1196765045 X:119235817-119235839 TGGAGGGCCCGGGAACGGCAGGG + Intergenic
1201304254 Y:12537168-12537190 TCAGGGGACCGCAAACGGCACGG - Intergenic