ID: 1037958183

View in Genome Browser
Species Human (GRCh38)
Location 8:23074916-23074938
Sequence AGAGAGAAGGAGAATGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037958183_1037958186 -8 Left 1037958183 8:23074916-23074938 CCCTTCTCATTCTCCTTCTCTCT No data
Right 1037958186 8:23074931-23074953 TTCTCTCTCCACCATGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037958183 Original CRISPR AGAGAGAAGGAGAATGAGAA GGG (reversed) Intergenic
No off target data available for this crispr