ID: 1037959855

View in Genome Browser
Species Human (GRCh38)
Location 8:23088477-23088499
Sequence CACGCACCACACATGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037959853_1037959855 -8 Left 1037959853 8:23088462-23088484 CCTGTGGTACAATATCACGCACC 0: 1
1: 0
2: 1
3: 4
4: 44
Right 1037959855 8:23088477-23088499 CACGCACCACACATGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037959855 Original CRISPR CACGCACCACACATGGAACC AGG Intronic
No off target data available for this crispr