ID: 1037959915

View in Genome Browser
Species Human (GRCh38)
Location 8:23089200-23089222
Sequence CTTTCTACCCTGAAGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037959915_1037959924 22 Left 1037959915 8:23089200-23089222 CCTACCTACTTCAGGGTAGAAAG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1037959924 8:23089245-23089267 AAAAGTAACTATTAGGTACTAGG No data
1037959915_1037959923 15 Left 1037959915 8:23089200-23089222 CCTACCTACTTCAGGGTAGAAAG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1037959923 8:23089238-23089260 GATCAGAAAAAGTAACTATTAGG No data
1037959915_1037959922 -7 Left 1037959915 8:23089200-23089222 CCTACCTACTTCAGGGTAGAAAG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1037959922 8:23089216-23089238 TAGAAAGTGGGAGGAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037959915 Original CRISPR CTTTCTACCCTGAAGTAGGT AGG (reversed) Intronic
902759579 1:18572408-18572430 GTTTCTGCCATGAGGTAGGTGGG - Intergenic
904537589 1:31210102-31210124 CATTCTACCCTGAATTTGGTGGG - Intronic
904951193 1:34240361-34240383 CATTCTATCCTGAAGCAGTTGGG - Intergenic
911095462 1:94051330-94051352 CTTTGAACCCTGAAGTGGCTTGG + Intronic
911264730 1:95729802-95729824 CTTCAGACCCTGAAGTAGCTGGG - Intergenic
913037946 1:114991597-114991619 TTTTCTACCATGAAGCATGTTGG - Intronic
919799865 1:201347401-201347423 TTTTCTGCACTGAAGTAAGTTGG - Intergenic
920137972 1:203785938-203785960 CTTTCTTCCTTGAAGTGGTTTGG + Intergenic
923003251 1:230024893-230024915 CCTTCTACCCAGCAGTATGTGGG + Intergenic
923234453 1:232019157-232019179 CCTCCTACCCAGAAGTAGGCAGG + Intronic
1063023224 10:2150536-2150558 CTTACTACCTTGAAGCAGGGTGG - Intergenic
1064461314 10:15537191-15537213 CTTTCTAGCCTGGATTAGGAGGG + Intronic
1065125204 10:22567413-22567435 CTTTCTCACCTGTAGTATGTTGG - Intronic
1071987856 10:91070775-91070797 CTTTCTCCCCTTAAGTTTGTTGG + Intergenic
1076507379 10:130987094-130987116 CTTTCCACTCTGAAGTAGGCTGG + Intergenic
1076886134 10:133263424-133263446 CTTTCTTCCCTGCAGTTGCTGGG + Intronic
1080186800 11:29498001-29498023 CCTTCTACTCTGTAGTTGGTTGG - Intergenic
1089079505 11:115764056-115764078 TTTTCTTTCCTGAAGGAGGTTGG - Intergenic
1089526179 11:119098233-119098255 CTCTCTACCCAGTAGTAGTTAGG - Intronic
1093902350 12:24650428-24650450 CTCTCAACCCTGAGGTATGTTGG + Intergenic
1095715362 12:45339989-45340011 CTTTTTACACTGAAAAAGGTGGG + Intronic
1097294678 12:57949789-57949811 CTTAAGACCCTTAAGTAGGTGGG - Intronic
1099567767 12:84274807-84274829 TTTTCTACCCTAAAGGAGATAGG - Intergenic
1099745539 12:86698881-86698903 CTTTCTCCCCTGAGGCACGTGGG - Intronic
1100951959 12:99860671-99860693 GTTTCTACCCTGCAGTGTGTTGG - Intronic
1101029217 12:100643629-100643651 CTTTCTTCCCTAGAATAGGTAGG + Intergenic
1104154312 12:126116534-126116556 CATTCTACCCTCAAGTACATGGG + Intergenic
1105460646 13:20582535-20582557 TTTTCTATCCTGAGGTAGGGTGG + Intronic
1107057063 13:36117872-36117894 CTTTCTCCTCTGAATTAGGATGG - Intronic
1112073710 13:95884012-95884034 CTTTCTACCCTAATTTAGTTAGG + Intronic
1115645541 14:35366484-35366506 CCTTCTCCCCTGGAGTAAGTGGG - Intergenic
1116657491 14:47671452-47671474 CTTTCTTCCCTGGAATAGCTAGG - Intronic
1117050138 14:51851579-51851601 CTTTCTACCCTTAAGTCTGTAGG - Intronic
1120479864 14:85036487-85036509 CTTTATCACCTGAAGTATGTAGG + Intergenic
1120872067 14:89346757-89346779 CTTTCTCCACTGAAAGAGGTGGG - Intronic
1121870228 14:97400524-97400546 CATTCTACCCTTGAGGAGGTAGG + Intergenic
1123208950 14:106739980-106740002 CTAATTACCCTGAAGAAGGTGGG + Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1131324838 15:91432232-91432254 GTTTCTTCCCTGGAGAAGGTGGG + Intergenic
1131698353 15:94904538-94904560 CTCCCTACCCTCAAGTAGCTGGG + Intergenic
1135148299 16:19982935-19982957 CCTTCTCCCCTGAATTAGGCCGG - Intergenic
1135968425 16:27054495-27054517 CTCTCCACCCTCAAGTAGGCCGG + Intergenic
1139385223 16:66564109-66564131 CTTTCTACTGTGAAGAAGGAAGG + Intronic
1141358342 16:83370620-83370642 CCCTCCACCCTTAAGTAGGTAGG + Intronic
1143644851 17:8223530-8223552 CTTTCCACCCTGCAGTGGGGCGG + Intergenic
1143801378 17:9385039-9385061 TTTTATAGCCTGGAGTAGGTAGG + Intronic
1144177181 17:12718585-12718607 TTTTCAACCCTAAAGTAGGTGGG + Intronic
1150041748 17:61869931-61869953 CTTTCTCCTCTTCAGTAGGTAGG + Exonic
1150867447 17:68868296-68868318 CAGTCTACCCTGGAGCAGGTGGG - Exonic
1150876450 17:68976130-68976152 CAGTCTACCCTGGAGCAGGTGGG - Exonic
1153024404 18:659566-659588 TTTTCTTCCCTGAAGAAAGTTGG + Intronic
1153839656 18:8995010-8995032 CTTTCAACCCTGAAGAAGCGTGG - Intergenic
1155089737 18:22494893-22494915 CTTTGTACCCTAAAATGGGTTGG + Intergenic
1155385591 18:25273917-25273939 CTTTCTACCCTGAAGTTCTGTGG - Intronic
1155648601 18:28112625-28112647 TTTACTACCATGAAGTATGTAGG + Intronic
1155834033 18:30556182-30556204 TTTTCTACTCTGAAGGAGTTTGG + Intergenic
1160029903 18:75249511-75249533 ATCTCACCCCTGAAGTAGGTAGG + Intronic
1162301139 19:9845918-9845940 CCTGCTTCCCCGAAGTAGGTGGG + Intronic
1165817304 19:38649939-38649961 CTGTCCATCCTGCAGTAGGTGGG - Intronic
926688964 2:15719615-15719637 CCTTCTTCCCTGAAGCAGGTAGG + Intronic
927977699 2:27351793-27351815 CTTTGAACCCTGAGGTAGGTGGG - Intronic
928134216 2:28676030-28676052 CTCTCTACCCTTAACTAGGCAGG + Intergenic
930185831 2:48411152-48411174 CTTGCAAGCTTGAAGTAGGTTGG + Intergenic
933507912 2:83202440-83202462 CTCTCTACCCTGAAGCAGAAGGG + Intergenic
935585017 2:104792811-104792833 CTTTCTCCCCTCCAATAGGTGGG - Intergenic
939323043 2:140649212-140649234 ATTTCCACCTTGAATTAGGTAGG - Intronic
939782569 2:146466167-146466189 CTTTCCTCCCTGAAGTACTTTGG + Intergenic
940635139 2:156290236-156290258 CTTTCTCCCTTGAATTAGCTTGG + Intergenic
940792723 2:158045341-158045363 CTTTCTAGCCTGAAGCACGGTGG + Intronic
941240415 2:163029454-163029476 CTTCTTACCCTGAAGTAGCAGGG + Intergenic
941303819 2:163835706-163835728 CCTTCTTCCCTGAAGGTGGTCGG - Intergenic
941376613 2:164739210-164739232 CTTATTATCCTGAATTAGGTTGG - Intronic
941621418 2:167783541-167783563 TTTTTTACCCTGAAGCAAGTTGG + Intergenic
942657574 2:178230076-178230098 CATTCTACCCTTAGGAAGGTTGG + Intronic
943471750 2:188303240-188303262 CTTTTTGCCCTGAAGGTGGTAGG + Intronic
945053533 2:205848386-205848408 CTTTTTCCCCTGAATCAGGTTGG - Intergenic
946340459 2:219063578-219063600 CTTCCTCCACTGAAGGAGGTTGG - Intergenic
1172417279 20:34780131-34780153 CTTCCCACTCTGAAGTATGTTGG + Intronic
1173015215 20:39219460-39219482 CTTTCCACAATCAAGTAGGTGGG - Intergenic
1178451796 21:32708474-32708496 ATTTCTAACCATAAGTAGGTAGG + Intronic
1181840056 22:25649431-25649453 CTTTGGACCCTGAAATCGGTTGG - Intronic
1182874877 22:33682922-33682944 ATTACTAACCTGAAGTGGGTTGG - Intronic
950443279 3:13022208-13022230 CTTCCTACCATGAAGAAGGAAGG - Intronic
951792213 3:26498495-26498517 ATTACTACTCTGAAGTTGGTTGG + Intergenic
960361637 3:116719194-116719216 GTTTCTACACTGAATTAGGAGGG - Intronic
960625712 3:119680074-119680096 CTTTCTTCCCTGAAGCAAGGAGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962267352 3:133953407-133953429 CTTTCTGCCCTTAAGAAGTTTGG - Intronic
965431777 3:168597695-168597717 CATTCCAGGCTGAAGTAGGTGGG - Intergenic
966772066 3:183512878-183512900 CTTTCTTCCCTGAAATTGGATGG - Intronic
970906162 4:21218877-21218899 GTTTCTACCCTAAAGCATGTGGG + Intronic
971065158 4:23023261-23023283 TTTTCTCCCCAGAAGTGGGTGGG + Intergenic
971131678 4:23818008-23818030 CTTTCCCCCCTGAAGTAAGAGGG + Intronic
971295985 4:25392360-25392382 CTTTCTTACCTGAAGTAACTCGG + Exonic
974101129 4:57418430-57418452 CTTTCTACCCTTCAAAAGGTAGG + Intergenic
974272538 4:59669695-59669717 CTTTGAACTCTGAAGTAGCTTGG + Intergenic
974420133 4:61662646-61662668 CTTTCCACCCAGAAGTCTGTCGG - Intronic
977742208 4:100499489-100499511 TTTTCTGCCCTGAATTAGATGGG + Intronic
984240069 4:177207628-177207650 CTTTTTACTCTAAAGTTGGTTGG + Intergenic
985409779 4:189671113-189671135 CTTTCTACCCTGAAGCCACTAGG - Intergenic
988612651 5:32741839-32741861 CCTTCGACTCTGGAGTAGGTGGG + Intronic
989353226 5:40512113-40512135 CTTTCTACTCTGAATTATTTTGG + Intergenic
996940621 5:129000888-129000910 CTTTCTATCCTGCAGCACGTGGG - Intronic
998418904 5:141965801-141965823 TCCTCTACCCTGTAGTAGGTAGG - Intronic
1000795941 5:165664566-165664588 CTTTCTCACCTCTAGTAGGTTGG + Intergenic
1001613062 5:173019257-173019279 CTTTTAACCCTGAAGTCGGCTGG + Intronic
1005772252 6:29085693-29085715 CTGACTACCCTGAAGTTGATAGG + Intergenic
1013493337 6:110672251-110672273 CTTTGCAGCCTGAAGTAGATGGG + Intronic
1015024874 6:128520509-128520531 CTTTCGCCCCTGAGGTAGTTTGG - Exonic
1016473056 6:144395725-144395747 CATGCTAACCTGAAGTAGCTGGG - Intronic
1017966386 6:159270662-159270684 ATTTCTCCCTTGAAGTAGGAGGG - Intronic
1021639791 7:22726277-22726299 CTTTCTGCCCTGAACCAAGTGGG + Intronic
1021674685 7:23068222-23068244 CTTCCTACCTGGAAGTACGTGGG - Intergenic
1021850408 7:24802782-24802804 CATTACACCCTTAAGTAGGTTGG - Intronic
1024816165 7:53274604-53274626 CTTGCTACCCTTAATTTGGTGGG + Intergenic
1026003876 7:66584933-66584955 CTGTCTTCCCTGACATAGGTGGG - Intergenic
1026592114 7:71706038-71706060 TTTTCTACCATGAGGCAGGTGGG - Intronic
1027373103 7:77528049-77528071 AACTCTACCCTTAAGTAGGTAGG - Intergenic
1027748013 7:82102801-82102823 CTTTCTAACCTGCAGCAGGGTGG - Intronic
1027888208 7:83936669-83936691 CTTTCTTTCCTGAAGTAAGGTGG + Intergenic
1028728842 7:94121682-94121704 GTTGCTTGCCTGAAGTAGGTTGG - Intergenic
1032077422 7:128842659-128842681 CAGTCCACCGTGAAGTAGGTGGG - Exonic
1033715007 7:143991804-143991826 TTTTCTTCCCTGAAGGAGGATGG + Intergenic
1036008066 8:4689935-4689957 CTTTCTCCCCTGCAGGAAGTGGG + Intronic
1037227482 8:16610391-16610413 CTTGCAACCCTGCAGTATGTTGG + Intergenic
1037959915 8:23089200-23089222 CTTTCTACCCTGAAGTAGGTAGG - Intronic
1042108099 8:65349950-65349972 TTCTCTGCCCTCAAGTAGGTTGG + Intergenic
1044422542 8:92014637-92014659 CTTACTACCCTGCAGCAGTTTGG - Exonic
1045584175 8:103512627-103512649 TTCTCTACCCTGAGTTAGGTAGG - Intronic
1047291786 8:123538181-123538203 CATTCTACACTGGAGAAGGTTGG + Intronic
1047298264 8:123590041-123590063 CTTACTAGGCTGAAGTAGGCTGG + Intergenic
1047934642 8:129764871-129764893 CTTTCTTCCCTGCTGCAGGTGGG + Intronic
1047981010 8:130182131-130182153 CTTTCTCCACTGATGTGGGTGGG + Intronic
1048780129 8:137990847-137990869 CTTGCCACCCTGGAATAGGTAGG + Intergenic
1052684388 9:31736292-31736314 ATTTCTCACCTGAAGTAGTTCGG - Intergenic
1055742317 9:79403452-79403474 ATGTCTTCCCTGAAGTAGGAAGG + Intergenic
1056878424 9:90362918-90362940 CTGTCCTCCCTGAAGTAGTTGGG + Intergenic
1061354774 9:130096257-130096279 CTTTTGACCTTCAAGTAGGTGGG + Intronic
1061734781 9:132646781-132646803 CTTTCTTCCCTGAATCAAGTCGG + Intronic
1203672977 Un_KI270755v1:34367-34389 CTTTCTACCCTGAAGCCACTAGG + Intergenic
1185762437 X:2699032-2699054 CTTTCGAGGCTGAGGTAGGTGGG - Intronic
1190792848 X:53716121-53716143 CTGTCTACCCTGGAGTATGTGGG - Intergenic
1192767421 X:74156110-74156132 CTTTCTCCCCTGAGATAGGATGG - Intergenic
1194094045 X:89614620-89614642 CTCTCCTCCCTTAAGTAGGTAGG - Intergenic
1198686326 X:139231546-139231568 GTGTCTACCATGAACTAGGTAGG - Intergenic
1199133308 X:144220263-144220285 CTTTCTACCCTGGAACAAGTGGG - Intergenic
1201554269 Y:15252360-15252382 TTCTATACCATGAAGTAGGTAGG - Intergenic