ID: 1037959921

View in Genome Browser
Species Human (GRCh38)
Location 8:23089211-23089233
Sequence CAGGGTAGAAAGTGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037959911_1037959921 28 Left 1037959911 8:23089160-23089182 CCTAATATGGATGCAAAGAGGTG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037959921 Original CRISPR CAGGGTAGAAAGTGGGAGGA GGG Intronic
No off target data available for this crispr