ID: 1037962024

View in Genome Browser
Species Human (GRCh38)
Location 8:23104982-23105004
Sequence CAGGAACTGAACTCAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 8, 3: 86, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037962024_1037962031 6 Left 1037962024 8:23104982-23105004 CCTGGAGCTGAGTTCAGTTCCTG 0: 1
1: 1
2: 8
3: 86
4: 269
Right 1037962031 8:23105011-23105033 GGTCCTGGCTCTGTCAATGCTGG 0: 3
1: 0
2: 2
3: 21
4: 173
1037962024_1037962032 7 Left 1037962024 8:23104982-23105004 CCTGGAGCTGAGTTCAGTTCCTG 0: 1
1: 1
2: 8
3: 86
4: 269
Right 1037962032 8:23105012-23105034 GTCCTGGCTCTGTCAATGCTGGG No data
1037962024_1037962026 -9 Left 1037962024 8:23104982-23105004 CCTGGAGCTGAGTTCAGTTCCTG 0: 1
1: 1
2: 8
3: 86
4: 269
Right 1037962026 8:23104996-23105018 CAGTTCCTGACCCCAGGTCCTGG 0: 2
1: 1
2: 6
3: 29
4: 293
1037962024_1037962034 11 Left 1037962024 8:23104982-23105004 CCTGGAGCTGAGTTCAGTTCCTG 0: 1
1: 1
2: 8
3: 86
4: 269
Right 1037962034 8:23105016-23105038 TGGCTCTGTCAATGCTGGGCTGG No data
1037962024_1037962035 29 Left 1037962024 8:23104982-23105004 CCTGGAGCTGAGTTCAGTTCCTG 0: 1
1: 1
2: 8
3: 86
4: 269
Right 1037962035 8:23105034-23105056 GCTGGTCCAATCTGTGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037962024 Original CRISPR CAGGAACTGAACTCAGCTCC AGG (reversed) Intronic
900622582 1:3594070-3594092 CAGGAACAGAACCCAGCTCTAGG - Intronic
901287164 1:8089913-8089935 CGGGGACAGAACTCAGCTGCCGG - Intergenic
903563967 1:24250451-24250473 CATGAACTGAAATCGTCTCCTGG + Intergenic
905363938 1:37438664-37438686 CAGGGACTGACCTCAGGTCTGGG - Intergenic
906790503 1:48654967-48654989 CAGTAATTGACCCCAGCTCCCGG + Intronic
908344524 1:63218223-63218245 CAGGTACTGTACTAAGCTCTGGG - Intergenic
908766786 1:67561411-67561433 CAGCAACTGCACCCACCTCCTGG - Intergenic
910448231 1:87320339-87320361 CAGGGACCGCTCTCAGCTCCTGG + Intergenic
911052106 1:93680513-93680535 CAGGATCTCAACTCAGTCCCAGG + Intronic
915836891 1:159184121-159184143 CAGGATTAGAACTCAGCCCCTGG - Intronic
917438928 1:175049128-175049150 CAGTAAGTGAACTAAGCTCAAGG - Intergenic
917441764 1:175074590-175074612 CAGGCACTGGACTCAACACCCGG - Intronic
917487251 1:175466533-175466555 CAGTAACTGAACAGAGATCCAGG - Intronic
917838276 1:178957891-178957913 CAGGACATGAGCCCAGCTCCAGG - Intergenic
919786404 1:201261096-201261118 CAGGCAGGGCACTCAGCTCCTGG - Intergenic
921262912 1:213399694-213399716 CAGGCAGTTAGCTCAGCTCCTGG - Intergenic
922047723 1:221962982-221963004 CAGGATTTGAACTCAGACCCAGG + Intergenic
923043678 1:230338437-230338459 CAGGAGCTGAACGCAGTCCCTGG - Intronic
923043679 1:230338438-230338460 CAGGGACTGCGTTCAGCTCCTGG + Intronic
924629869 1:245726637-245726659 CAGGACCTGCACTCAGCTCTGGG + Intergenic
1062810681 10:461650-461672 CAGGACTTGAACTCAGCTCTGGG + Intronic
1063093345 10:2887458-2887480 CACGAGCTGAAGACAGCTCCTGG - Intergenic
1063510211 10:6637398-6637420 CAGGCACTGCTCTTAGCTCCTGG + Intergenic
1069723148 10:70562155-70562177 CAGGACCTGAACCCAGCTCATGG + Intronic
1070417739 10:76206146-76206168 CAGGAGCTGAACTCAGCAGTGGG + Intronic
1070437911 10:76411759-76411781 CAGTCTCTGAACTCAGCACCAGG + Intronic
1071826451 10:89330541-89330563 CAAGAACTGAACCCAGATCTTGG + Intronic
1072872551 10:99135325-99135347 CAGGACTTGAATTCAGCTCTGGG + Intronic
1074396711 10:113104063-113104085 AAGGCACTGAACTCAGATCCTGG - Intronic
1074858293 10:117489787-117489809 CAGGCCCTGAGCTCAGCTCTGGG - Intergenic
1075146097 10:119884373-119884395 CAGGAAAGCCACTCAGCTCCAGG + Intronic
1076594716 10:131618600-131618622 CAGGGCCTGAACTCAGAGCCAGG - Intergenic
1077353261 11:2102793-2102815 AAGGAACTGACTTCAGCTCCGGG - Intergenic
1078622069 11:12917378-12917400 CAGAAATTTAATTCAGCTCCAGG - Intronic
1078685936 11:13532196-13532218 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1078724188 11:13913982-13914004 CAGGAACTGTACTAGGCTCTGGG + Intergenic
1079335577 11:19567681-19567703 GAGGGACTGAATTAAGCTCCAGG - Intronic
1080714645 11:34788653-34788675 CAGGACTTGAACTCAGGTACTGG - Intergenic
1080827138 11:35857974-35857996 CAGGAACTGTACTGAGTCCCGGG - Intergenic
1082756468 11:57081508-57081530 CAGCAACTGAAGTCACTTCCTGG - Intergenic
1082924878 11:58534141-58534163 CAGGACTTGAACTCAGCTCTTGG + Intronic
1083298453 11:61727755-61727777 CAGAAACCAAACTAAGCTCCTGG - Intronic
1084019573 11:66409563-66409585 CAGGATCCTAACTCTGCTCCAGG - Intergenic
1085003648 11:73063907-73063929 CAGGACCTAAACTCAGCTCTGGG + Intronic
1085842940 11:80034268-80034290 CAGGAGTTGACCTCAGCTACTGG - Intergenic
1086792245 11:91057105-91057127 CAAGACTTGAACTCAGCTCTGGG - Intergenic
1087716776 11:101617630-101617652 CAGGTACTGAAGAGAGCTCCTGG - Intronic
1089110775 11:116054225-116054247 AGGGACCTAAACTCAGCTCCAGG + Intergenic
1089882143 11:121784949-121784971 CAGGACTTGAACTCAGCTCTCGG - Intergenic
1090279861 11:125446301-125446323 CAGGATTTGAACTCAGGCCCCGG - Intronic
1090394692 11:126411083-126411105 GAGGACCTGAACCCAGCTCCTGG + Intronic
1091283589 11:134395991-134396013 CTGGGACTGCCCTCAGCTCCTGG + Intronic
1091292622 11:134450341-134450363 GAGGAAGTGGACTCAGCACCTGG + Intergenic
1093335785 12:17903591-17903613 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1093522759 12:20069392-20069414 CAGGACTTGAACTCAGCTCTGGG + Intergenic
1094443902 12:30508913-30508935 ATGTAACTGAACTCAGGTCCAGG - Intergenic
1097488696 12:60237260-60237282 TAGGAATTCAACTCAGCTCTGGG + Intergenic
1097583230 12:61483683-61483705 CAGGACCTGAACTCAGCACTGGG + Intergenic
1098674266 12:73268847-73268869 CAGGACCTGAACTCAGCTCTAGG + Intergenic
1100598637 12:96093108-96093130 CAGGAACTGCCCACAGCTTCAGG + Intergenic
1101584292 12:106071011-106071033 CAGGAACTGAATTTAGCACCTGG + Intronic
1102614941 12:114145424-114145446 CAGCTACTGATCTTAGCTCCAGG + Intergenic
1103590857 12:121991233-121991255 CAGGCTCTGAACTAAGCTGCCGG + Intronic
1104042735 12:125141089-125141111 GAGGAAGTGAACTCAGGTTCAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104932584 12:132347650-132347672 CATGAAATGAACTCAGCAGCGGG - Intergenic
1105672438 13:22634571-22634593 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1107064491 13:36197850-36197872 TAGGAACTGAAGACAACTCCAGG - Intronic
1107243932 13:38269608-38269630 CAGGACTTGAACTCAGCTCTAGG + Intergenic
1107311495 13:39083119-39083141 CAGGAATTGAACCCTGCACCTGG - Intergenic
1108060072 13:46524089-46524111 AAGGACCTGAGCTCTGCTCCTGG - Intergenic
1109271943 13:60265827-60265849 CAGGTACTGTACTAAGCTCTAGG + Intergenic
1109869877 13:68320952-68320974 CAGGAAAAGAAGCCAGCTCCTGG - Intergenic
1111478470 13:88786672-88786694 CAGTACCTGAACTCAGCACTAGG - Intergenic
1112102471 13:96204469-96204491 CAGGACCTGAACTCAGGTCTGGG + Intronic
1112200383 13:97268724-97268746 CAGGCACTGAACTGAACTCTGGG + Intronic
1115818696 14:37190405-37190427 CAGGACTTGAACTCAGCTCTGGG + Intergenic
1115866920 14:37758204-37758226 CAGGACTTGAACTCAGCTCTGGG - Intronic
1118415837 14:65535803-65535825 TAGGAACTGAACTCAACACTGGG - Intronic
1118790904 14:69091805-69091827 CAGCAACGGGACCCAGCTCCTGG - Exonic
1119715744 14:76857958-76857980 CAGGATCTGAAGTCACCTCCTGG - Intronic
1121470474 14:94150177-94150199 CAGGACTTGAACTCAGCTATGGG - Intronic
1121613506 14:95297160-95297182 CAGGAACTCCACTGAGCCCCAGG - Intronic
1122115335 14:99524744-99524766 CAGGAGCTGAAATCACCTGCTGG + Intronic
1122291374 14:100682014-100682036 TGGGGAATGAACTCAGCTCCGGG - Intergenic
1124137578 15:27048466-27048488 GAGGGACTGAGGTCAGCTCCTGG - Intronic
1124270196 15:28273628-28273650 CAGGAAGTGGACTCAGAGCCGGG + Intronic
1125604868 15:40934491-40934513 CAGGGAATGCACTCACCTCCAGG - Intronic
1126876857 15:53052255-53052277 CAGGACTTGAACTCAGCTCTGGG + Intergenic
1127100180 15:55556123-55556145 CAGGACCTGCACTCAGCTCTGGG + Intronic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1127918347 15:63473686-63473708 CAAGATCTGAATTCAGATCCTGG - Intergenic
1129459376 15:75692799-75692821 CAGGAACTGAAAGCAGTTCAGGG + Intronic
1129724587 15:77895087-77895109 CAGGAACTGAAAGCAGTTCAGGG - Intergenic
1130059625 15:80560087-80560109 CAGGATCTGAAGACGGCTCCTGG - Intronic
1130907961 15:88253294-88253316 CAAGAACTGACCCCAGCTGCGGG + Intronic
1132285477 15:100659094-100659116 CAGCAACCGAACTCAGGTGCCGG - Intergenic
1132888968 16:2195138-2195160 CCGGACCTGAAATCAGCTCGGGG + Intronic
1133976144 16:10601108-10601130 TGGGAACTGCACTCAGCTCTTGG + Intergenic
1134096633 16:11423058-11423080 CTGGCAGCGAACTCAGCTCCGGG + Intronic
1134159445 16:11874720-11874742 CAGGAACTGTATTCATCACCAGG + Intronic
1134219646 16:12343755-12343777 CAGGCACTGATCTGAGCTCTGGG - Intronic
1135618321 16:23931279-23931301 CAGAAACTGAATTCTGGTCCTGG - Intronic
1136248752 16:28989998-28990020 CAGGAGCTGAACTGAGGGCCTGG + Exonic
1137439353 16:48484803-48484825 CAGGTACTGGGCTCAGCTCCAGG - Intergenic
1137702865 16:50509770-50509792 CAAAACCTGAACTCAGCCCCAGG - Intergenic
1137720881 16:50626657-50626679 CAGGACCTGAAATCAAATCCAGG - Intronic
1138557745 16:57782516-57782538 CAGGGTTTGAACCCAGCTCCAGG + Intronic
1141245859 16:82306932-82306954 CAGGACTTGAACTCATCTCTGGG - Intergenic
1141482318 16:84314681-84314703 CAGGAACTGGCCGCTGCTCCAGG + Intronic
1141950648 16:87337078-87337100 CAGGAGCTGCACTGAGCACCTGG + Intronic
1142235827 16:88922099-88922121 CAGCCATTGAACCCAGCTCCCGG - Intronic
1142722204 17:1784024-1784046 CTGGAACTGCACACAGCTCACGG + Intronic
1143381922 17:6501962-6501984 AAGGAACTGAGCTCAGCACAAGG - Intronic
1146825676 17:36021085-36021107 AAGGACTTGAACTCAGCTCTGGG - Intergenic
1147314819 17:39614739-39614761 CAGGAACTGGACCCAGAGCCTGG + Intergenic
1147510054 17:41060168-41060190 CAGGAAATGACCTCATGTCCTGG - Intergenic
1147525587 17:41219121-41219143 CAGGACTTGAACTCAGCTCTGGG + Intronic
1149093602 17:52814948-52814970 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1151790778 17:76304492-76304514 CAGGAACCAAACTCAGCTTCCGG + Exonic
1151849806 17:76683624-76683646 CAGGGACTTAACTCCCCTCCAGG + Intronic
1152913623 17:83020374-83020396 CTGGAAGTGGACTCGGCTCCTGG - Intronic
1153094595 18:1385935-1385957 CAGGACCTGTACTCAGCACTGGG + Intergenic
1153304720 18:3621116-3621138 GAGCCACTGAACTCAGCCCCAGG - Intronic
1153413595 18:4821416-4821438 CAGTTACTGAACTCAGCTGCAGG - Intergenic
1153745333 18:8173009-8173031 AAGGAACTGTACTCAGTTCAGGG + Intronic
1154366495 18:13714681-13714703 CAGGAACTTAATTTAGATCCTGG + Intronic
1155185698 18:23384766-23384788 TATGAACTGAACTCAGATCCAGG - Intronic
1156266858 18:35497160-35497182 AAGGCACTGAGCTCAGCGCCTGG - Intronic
1156353248 18:36319604-36319626 CAGGACTTGAACTCAGCTCTGGG + Intronic
1156529680 18:37803427-37803449 CAGGATGTGAACTCGGCTCTGGG - Intergenic
1157322173 18:46642926-46642948 CAGGAACAGCACACAGCTCATGG + Intronic
1157660622 18:49439050-49439072 CAGTAACTGATCCCATCTCCTGG + Intronic
1158964384 18:62610571-62610593 CAGGGACTGAAATGACCTCCAGG - Intergenic
1160605478 18:80046565-80046587 CAGGGACGGAGCCCAGCTCCAGG - Intronic
1161054675 19:2184403-2184425 CAGGACCTGACCTCAGGTCCGGG - Intronic
1161985083 19:7648628-7648650 CAGAAGCTGAACACAACTCCTGG - Intergenic
1163963604 19:20722157-20722179 CAGGACTTGAACTCAGCTCTGGG - Intronic
1163995757 19:21045592-21045614 CAGGACTTGAACTCAGCTTTGGG - Intronic
1164013536 19:21231391-21231413 CAGAACTTGAACTCAGCTCTGGG + Intronic
1164067900 19:21736518-21736540 CAGGACTTGGACTCAGCTCTAGG + Intronic
1164235168 19:23325390-23325412 CAGGAACAGAACTCACGCCCAGG - Intronic
1164818768 19:31227753-31227775 CATGCCTTGAACTCAGCTCCAGG + Intergenic
1165337001 19:35177868-35177890 CAGAAACTGTATTCAGCTTCAGG + Intergenic
925033736 2:671339-671361 CAGGGACTGAACACCCCTCCTGG + Intronic
925312613 2:2896525-2896547 CTGGAACTGAACTCAAATACAGG - Intergenic
925332516 2:3069841-3069863 CATGAAATGAACTGAGTTCCTGG + Intergenic
925460615 2:4059654-4059676 GAGCAAATGAACTCATCTCCTGG + Intergenic
925778307 2:7356524-7356546 TAGGAACTGCATTCAACTCCTGG - Intergenic
925891645 2:8439477-8439499 CTGAAAATGAGCTCAGCTCCAGG - Intergenic
926287670 2:11502843-11502865 CAGCAACAAAACTCACCTCCTGG - Intergenic
926314195 2:11697433-11697455 CAGGAGCCGAGCACAGCTCCTGG - Intronic
926989488 2:18662295-18662317 CAGAGACTGAAATCTGCTCCTGG + Intergenic
927884025 2:26707461-26707483 CATGAGCAGAACACAGCTCCCGG - Intronic
928608988 2:32973163-32973185 CAGGAGCTGAACTCAACACTTGG - Intronic
928728880 2:34207499-34207521 CAGGACTTGAACTCAGCTCTGGG + Intergenic
929186444 2:39100317-39100339 AAGGAAATGAAATCAGCACCTGG + Intronic
930025143 2:47025133-47025155 CAGGAAATGGGCTGAGCTCCAGG + Intronic
930764749 2:55073869-55073891 CAGAAACTGAGCTCAGGTCCTGG - Intronic
931069303 2:58626572-58626594 CAGGCAGTCATCTCAGCTCCCGG + Intergenic
931852119 2:66262354-66262376 CTGGAACTGAATTCTACTCCTGG + Intergenic
932646519 2:73508745-73508767 CAGGACTTGAACTCAGCTCAAGG - Intronic
933325346 2:80829114-80829136 GAGAACCTGAACTCAACTCCTGG - Intergenic
934861232 2:97764967-97764989 CAGCAACAGAACACAGCCCCTGG - Intronic
935064130 2:99633465-99633487 CAGGAAAGGAAAACAGCTCCAGG + Intronic
935399687 2:102646932-102646954 CAGGACTTGAACTCAGCTCTGGG + Intronic
936908509 2:117565846-117565868 CAGGACTTGAACTCTGCTCTGGG - Intergenic
937057925 2:118954770-118954792 CAGCAACTTTACCCAGCTCCAGG - Intronic
938672607 2:133600188-133600210 CAGAGACTTAATTCAGCTCCTGG + Intergenic
939493773 2:142904958-142904980 CAGGAACTCAGCCCAGCTCTAGG - Intronic
939625697 2:144474240-144474262 CAGGAACTGTCCTCTTCTCCTGG + Intronic
939685497 2:145194025-145194047 CATGACCTTTACTCAGCTCCAGG - Intergenic
941714855 2:168753173-168753195 CAAGAACTGAGCCCAGCACCAGG + Intronic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
942543685 2:177040465-177040487 CAGGATTTGAACTCAACACCGGG + Intergenic
942547194 2:177077454-177077476 CAGGATTTGAATTCAGATCCTGG + Intergenic
947540896 2:230977102-230977124 CATGAACTGAACTCATATCCAGG + Intergenic
1170375931 20:15699970-15699992 CACTAACTTGACTCAGCTCCAGG + Intronic
1170492393 20:16891253-16891275 CAGGACCTGAACTCAGCTCTGGG + Intergenic
1170625311 20:18025810-18025832 CAGTGACTGACCTCAGCTCCTGG - Intronic
1173723586 20:45280904-45280926 TAGGACCTGAACTCACCTCTTGG - Intergenic
1174028993 20:47605671-47605693 CATGAACCCAACTGAGCTCCAGG - Intronic
1174764121 20:53235468-53235490 CAGGATATGAACTCAAGTCCTGG - Intronic
1175531297 20:59675378-59675400 GAGGAGCTGGACTCAGATCCAGG - Intronic
1176076102 20:63248918-63248940 CGGCAGCTGAACACAGCTCCCGG + Intronic
1177042422 21:16130725-16130747 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1178811232 21:35883468-35883490 CAGGACCTGAACTCAGCTCTGGG + Intronic
1179068077 21:38045026-38045048 AAGGAACTAAAGTCAGCACCAGG - Intronic
1180092519 21:45540325-45540347 CAGGAGCTGAACTAAGCCCAGGG + Intronic
1181349948 22:22247763-22247785 CAGGAGTCCAACTCAGCTCCCGG - Intergenic
1181907826 22:26213292-26213314 AAGGAAGTGAATTCAGCTTCTGG + Intronic
1182528939 22:30940619-30940641 AAGGAACTGAACTATGCTTCAGG + Intronic
1182577581 22:31283415-31283437 CAGGACCCAAACTCAGGTCCAGG + Intronic
1182731839 22:32502326-32502348 CAGGCAATGAGCTCTGCTCCAGG + Intergenic
1182892338 22:33829502-33829524 CAGGAACTGTACTAAGCACCGGG - Intronic
1183623700 22:38989249-38989271 CAGGAAGTCAACACAGCCCCGGG - Intronic
1184682929 22:46081664-46081686 CAGCCACTGAGCCCAGCTCCTGG - Intronic
949222445 3:1652102-1652124 CAGGACTTGAACTCAGCTCTGGG - Intergenic
949356645 3:3187980-3188002 CAGGAATGGATCTCAGGTCCAGG - Intergenic
950209927 3:11115753-11115775 CAGGATCTGCACTCAGCTCTCGG + Intergenic
950652174 3:14414076-14414098 CAGCACCTGGACTCAGCCCCAGG - Intronic
951789716 3:26466629-26466651 CAGGACTTGAACTCAGCTCTGGG + Intergenic
952503471 3:33986701-33986723 CAGGACTTGAACTCAGCTCTGGG - Intergenic
952694839 3:36252529-36252551 CAGGACTTAAACTCAGCTCTGGG + Intergenic
957427806 3:80063392-80063414 CTCTAACTGGACTCAGCTCCGGG - Intergenic
958815431 3:98909090-98909112 CAGGACCTGAATTCAGTTCTGGG + Intergenic
958918876 3:100080492-100080514 CAGGTACTAAATTCAGATCCTGG - Intronic
959170001 3:102832676-102832698 CAGGACCTGAACTCAGCAGTGGG + Intergenic
960044597 3:113184571-113184593 CAGGATTTGAACTCAGGTCTAGG - Intergenic
960177553 3:114534606-114534628 CAGGACTTGAACTCAGCCCTGGG + Intronic
961082175 3:124035603-124035625 CAGGAACTGAGCTCTGCTACGGG - Intergenic
961242662 3:125425626-125425648 CAGAACCTGAACTCATCTTCAGG - Intergenic
961818846 3:129565013-129565035 CAGGAGATGAAATCAGCCCCTGG - Intronic
962050432 3:131808052-131808074 CTGAAACTCAGCTCAGCTCCTGG + Intronic
962488932 3:135872039-135872061 CAGGAGCTGTACTCATTTCCAGG + Intergenic
963416029 3:144996791-144996813 CAGGACTTGAACTCAGCTCTGGG - Intergenic
964081567 3:152764881-152764903 CAGGACTTGAACTCAGCTCTGGG + Intergenic
964898794 3:161631682-161631704 CAGACACTGTACTCATCTCCAGG + Intergenic
964917591 3:161855041-161855063 CTGTAACTTGACTCAGCTCCAGG + Intergenic
966251335 3:177868304-177868326 CAGGACTTGAACTCAGCTCTGGG + Intergenic
966449444 3:180041213-180041235 AGGGAAATGAACTCAGCTCCAGG + Intergenic
969401412 4:6958133-6958155 CAGCAGCTGAACACAGCGCCAGG + Intronic
970299817 4:14669402-14669424 CAGGACCTTAACTCAGCCCCTGG - Intergenic
970583030 4:17490686-17490708 CAGGAGCTGAAGTCAGCCTCAGG + Exonic
970869357 4:20797728-20797750 CAGGGACTGCTCTTAGCTCCTGG - Intronic
971708314 4:30077565-30077587 CAGGACCTGAACTCAGCACTGGG - Intergenic
973573219 4:52261306-52261328 CAGGAAAAGAGCTCAGCTTCGGG - Intergenic
974259238 4:59503551-59503573 CAGGCACTGAACCCAGCTGAGGG + Intergenic
974306845 4:60153934-60153956 CAGTACTTGAACTCAGCTCTGGG - Intergenic
974797564 4:66772625-66772647 CAGAACCTGAACTCAGCACTGGG - Intergenic
974899479 4:67979876-67979898 CAGGACCTGAACTCAGCGCTGGG - Intergenic
975121066 4:70729181-70729203 AAGGAACTGAATCCAGGTCCAGG - Intronic
977592170 4:98839478-98839500 CAGGGACTGCTCTCAGCTCCTGG - Intergenic
977987089 4:103395646-103395668 CAGGACTTGAACTCAGCTCTGGG + Intergenic
978090562 4:104709490-104709512 CAGGACTTGAACTCAGCTCTGGG + Intergenic
980159972 4:129149146-129149168 CAGTAACTGAACACAGGTTCAGG - Intergenic
981022164 4:140040403-140040425 CACAAACAGAACTCATCTCCAGG + Intronic
983026955 4:162749896-162749918 CAGGAAATGTGCACAGCTCCAGG + Intergenic
983495163 4:168435239-168435261 CAGCAACTCAACACATCTCCAGG + Intronic
986664986 5:10093950-10093972 AAGGACTTGAACTCAGCTCTGGG + Intergenic
988159214 5:27497290-27497312 CAGTTACAGAACTCAGCTTCTGG + Intergenic
988704052 5:33706224-33706246 CAGGACTTGAACTCAGCTCTGGG - Intronic
990314550 5:54571719-54571741 CAGGCACAGAACCCAGCTCAGGG - Intergenic
990317529 5:54597356-54597378 CAGGACTTGAACTCAGCCCTGGG + Intergenic
990360080 5:55009616-55009638 TAGGACCTGAACTCAGCTCTGGG + Intronic
990835845 5:60018951-60018973 CAGGACCTGAACTCAGCTCTAGG + Intronic
990892127 5:60661163-60661185 CAGGAACCCAGCTCAGCTCTAGG + Intronic
991024585 5:62016162-62016184 CAAGACCAGAACTCATCTCCTGG + Intergenic
991483300 5:67106833-67106855 CAGGCACTGAACTCAGTACCAGG - Intronic
996427643 5:123332876-123332898 CAGGACTTGAACTCAGCTCTGGG - Intergenic
997213848 5:132094588-132094610 CAGGAACTGTACTCAGGTCCAGG + Intergenic
998608779 5:143665136-143665158 CAGGTACTGCCCTCAGCACCTGG - Intergenic
998691353 5:144592255-144592277 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1001175753 5:169467536-169467558 AAGGAAGTGAAGGCAGCTCCAGG + Intergenic
1002285938 5:178162756-178162778 CAGGATCTGAACGCTGCTCCCGG + Intergenic
1002565152 5:180108772-180108794 CTGGCCCTGACCTCAGCTCCAGG - Intronic
1002819875 6:714810-714832 CAAGAACTGTGCTCAGCTTCAGG - Intergenic
1003551597 6:7106899-7106921 CAGGAACCGTCCTCAGCCCCTGG + Intergenic
1004760377 6:18659043-18659065 CAGGACTTGAACTCAGCTTTGGG + Intergenic
1004883564 6:20031651-20031673 AAGGAACTGCACGCAGCTTCTGG + Intergenic
1006046670 6:31304935-31304957 AAGGAACTGAAGTCAGCCTCTGG + Intronic
1006083657 6:31581581-31581603 CAGAAACAGATCTCAGCCCCGGG - Exonic
1008175953 6:48268510-48268532 CAGTACTTGAACTCAGCTCTGGG - Intergenic
1009794809 6:68453789-68453811 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1010446742 6:75957433-75957455 CAGGACTTGAACTCAGCTCTGGG - Intronic
1011585782 6:88923925-88923947 CATGGACTGAAACCAGCTCCTGG - Intronic
1011796555 6:90959879-90959901 AAGAAACTGAACTCAGCATCAGG - Intergenic
1012062828 6:94510912-94510934 GAGGGACTGAACTCACCTCCTGG + Intergenic
1012075277 6:94674834-94674856 AAGGACTTGAACTCAACTCCGGG + Intergenic
1012625047 6:101394127-101394149 CAGGAAGTGGCCTCAGCTACGGG + Intergenic
1013461788 6:110381202-110381224 TAGGACTTGAACTCAGCTCTGGG + Intergenic
1013543356 6:111133077-111133099 CAGGAACCCAGCCCAGCTCCAGG + Intronic
1013637673 6:112044596-112044618 CTGGAATAGAACCCAGCTCCTGG - Intergenic
1013926423 6:115478562-115478584 CGGGACTTGAACTCAGCTCTGGG - Intergenic
1014544603 6:122718857-122718879 CAGGATCTGGTCACAGCTCCTGG - Intronic
1015284451 6:131469352-131469374 CAGGAAATGATCTCAGCTCCTGG - Intergenic
1016901701 6:149109066-149109088 CAGGCACTGAACTAAGGACCAGG - Intergenic
1017090019 6:150750873-150750895 CAAGAACTGAATCCAGATCCTGG + Intronic
1017348623 6:153414344-153414366 CAGGAATTGAACCCTGATCCTGG + Intergenic
1017675572 6:156810408-156810430 GAGGAACTTGCCTCAGCTCCTGG + Intronic
1017675575 6:156810426-156810448 CAGGAATCCAACGCAGCTCCAGG - Intronic
1017765316 6:157602523-157602545 CAGAACCTGCACACAGCTCCCGG - Intronic
1017963517 6:159243907-159243929 CAGGAAGTGAACTCATTTGCTGG + Intronic
1017973733 6:159336068-159336090 CAGGATCTGACCTCCGCCCCAGG - Intergenic
1020282795 7:6658846-6658868 CAGGACCTGCCCCCAGCTCCAGG + Intergenic
1021398355 7:20179567-20179589 CAGGAACTGAACTGTTCACCAGG - Intronic
1021694806 7:23266536-23266558 CAGGAATCCTACTCAGCTCCAGG - Exonic
1022790603 7:33685162-33685184 CAAGAACTTAACTCAGTGCCTGG - Intergenic
1024051426 7:45626149-45626171 CAGCAACTCAACTCTGCTCTTGG + Intronic
1024085762 7:45890202-45890224 TAGGAACTGAACTCTAATCCTGG + Intronic
1024770551 7:52716656-52716678 CAGAAACTGATTTCAACTCCTGG + Intergenic
1027338138 7:77176194-77176216 CCGGAACCCAACTCTGCTCCTGG + Intronic
1027535814 7:79399451-79399473 AAGCAACTGAACCCAGCCCCTGG - Intronic
1029777587 7:102694599-102694621 CCGGAACCGAACTCTGCTCCTGG - Intergenic
1030681877 7:112442689-112442711 CAGCAACAGAACTCAGTACCAGG - Intronic
1030882345 7:114895813-114895835 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1031685123 7:124723994-124724016 CAGGAAATGCACTTATCTCCAGG - Intergenic
1032399829 7:131617044-131617066 CAGGAACTGACCTCAGGAGCTGG + Intergenic
1032455838 7:132072783-132072805 CAGAAACTGAACCCAGCTCTGGG - Intergenic
1032914232 7:136469950-136469972 CAGGATCTGAACTCAGCTCTGGG - Intergenic
1035470151 7:159104478-159104500 CAGGAACTGGACTGGGCACCTGG - Intronic
1035672075 8:1425834-1425856 CAGGCACTGAACTGAACTTCTGG - Intergenic
1035913956 8:3598612-3598634 CAGGAACTGTACTGAGCTCTTGG - Intronic
1037957679 8:23071571-23071593 CCGGAACTGAGCTCAGCTCCAGG - Intergenic
1037962024 8:23104982-23105004 CAGGAACTGAACTCAGCTCCAGG - Intronic
1037969430 8:23161427-23161449 CAGGAACTGAGCTCAGCTCCAGG + Intronic
1037977106 8:23221526-23221548 GAGAAACTGAGCTCAGCTCCAGG + Intronic
1038242522 8:25823113-25823135 CAGGAACTTAAATCATCCCCAGG + Intergenic
1038768315 8:30451484-30451506 CAGAATCTCAACTCAGTTCCTGG - Intronic
1039981709 8:42413978-42414000 CAGGAGCTGAACTCTGAGCCTGG + Intergenic
1040443218 8:47466141-47466163 CAGGACCTAAACTCAGCACTGGG + Intronic
1040668773 8:49661263-49661285 CAGGACCTAAACTCAGCACTGGG + Intergenic
1040800151 8:51331253-51331275 CTCTAACTCAACTCAGCTCCAGG - Intronic
1042246468 8:66713006-66713028 CAGGATCTGAATTCACCTCGTGG - Intronic
1042548187 8:69969889-69969911 CATGAGATGAAATCAGCTCCTGG + Intergenic
1043324807 8:79036524-79036546 AAGGACCTGAACTCAGCTCTGGG + Intergenic
1045876304 8:106985218-106985240 CAGGAACTGTCCTCAGCTGATGG - Intergenic
1047516778 8:125561967-125561989 CAGGAACGGAACTCAGGTATTGG - Intergenic
1048041222 8:130730534-130730556 CAGGACCTGAAATTAGCTCCAGG - Intergenic
1048467313 8:134676563-134676585 CAGGACTTGAACTCAGCTCTGGG + Intronic
1048494174 8:134921554-134921576 CAGGAATGGAACACAGCTGCCGG + Intergenic
1048913794 8:139162941-139162963 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1049418979 8:142508528-142508550 CAGGATCTGCACTCTGCTCAGGG + Intronic
1049548448 8:143245709-143245731 CAGGAGCTGCTCTCAGCTCCCGG - Intergenic
1050239642 9:3621854-3621876 CAGGACTTGAACTCAGCCCTGGG - Intergenic
1051139337 9:13961760-13961782 CAGGAACTGAGCTCAACATCAGG - Intergenic
1055812694 9:80168160-80168182 CTTGAAATGAAATCAGCTCCTGG - Intergenic
1056791273 9:89626908-89626930 CAGGGAGTGAACACAGCTCCCGG + Intergenic
1056844941 9:90029593-90029615 CAGGGGCTGCTCTCAGCTCCTGG + Intergenic
1059426841 9:114226633-114226655 CCAGAACTGACCACAGCTCCAGG + Intronic
1059539772 9:115118592-115118614 CAGGGACTGAGCCCAGTTCCTGG + Intergenic
1060196601 9:121628190-121628212 CAGCATCTCCACTCAGCTCCAGG - Intronic
1060410311 9:123395687-123395709 CAGGAACTGTGCTCAGCCCCAGG - Intronic
1060656255 9:125374552-125374574 CAGGCACTGAGCTGGGCTCCAGG - Intergenic
1061576740 9:131512130-131512152 CAGGACCTGCACTCACCTCCTGG - Exonic
1061825907 9:133258055-133258077 CTGAAACTGAACGCAGCTCAAGG - Intronic
1061826749 9:133262580-133262602 CAGGAACTGGTCTGGGCTCCTGG - Intronic
1061885742 9:133590294-133590316 CTCGAACTGAGCCCAGCTCCTGG + Intergenic
1062092204 9:134684231-134684253 CGGGAACTTAAATCAGTTCCTGG - Intronic
1187839689 X:23474509-23474531 CAGGACTTGAACTTAGCTCTGGG - Intergenic
1187925142 X:24242939-24242961 CAGGAACTGAGAACAGCTTCTGG + Intergenic
1188793839 X:34438303-34438325 AAGGAACTGAGCTCAGCACTGGG + Intergenic
1188806720 X:34599956-34599978 CAGGAAGTGAACTCAACACTGGG - Intergenic
1189205372 X:39233772-39233794 CAGGAATTGCTCACAGCTCCTGG + Intergenic
1190553841 X:51614069-51614091 CAGGTACTGAAGTAGGCTCCTGG - Intergenic
1191667478 X:63718380-63718402 CAGAAACAGACCTCATCTCCAGG + Intronic
1192004497 X:67195361-67195383 CAGGACTTGAATTCAGCTCTGGG + Intergenic
1192915798 X:75649978-75650000 CAGGACTTGACCTCAGCTCTGGG - Intergenic
1192980207 X:76331189-76331211 CAGGACTTGAACTCAGATCTGGG - Intergenic
1193001798 X:76570649-76570671 CAGGACTTGAACTCAGCTCAGGG + Intergenic
1195548670 X:106141242-106141264 CAGAACCTGAACTCAGCACTGGG + Intergenic
1195585691 X:106563116-106563138 CAGGACCCAAACTCAGATCCTGG - Intergenic
1195774558 X:108389240-108389262 CAGGACTTGAACTCAGCTCTGGG - Intronic
1195979094 X:110558950-110558972 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1196178899 X:112669166-112669188 CAGGCACGGAACTGGGCTCCAGG + Intronic
1196496691 X:116331912-116331934 CAGGACCTGAACTCAACACTTGG + Intergenic
1197098077 X:122619349-122619371 CAGGAGTTGAACTCAGCTCTGGG - Intergenic
1197395344 X:125920850-125920872 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1197482717 X:127006964-127006986 CAGGACCTGACCTCAGCACTGGG + Intergenic
1197614035 X:128672539-128672561 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1199478956 X:148276334-148276356 CAGGACCTGAACTCAGCTTGGGG + Intergenic
1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG + Intergenic
1199725086 X:150572141-150572163 TGGGACCTGAACTCAGCTTCTGG - Intronic
1201763572 Y:17561476-17561498 CAGGGACTCCACGCAGCTCCTGG + Intergenic
1201837981 Y:18344514-18344536 CAGGGACTCCACGCAGCTCCTGG - Intergenic