ID: 1037965835

View in Genome Browser
Species Human (GRCh38)
Location 8:23133463-23133485
Sequence CTGTGGGAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037965826_1037965835 15 Left 1037965826 8:23133425-23133447 CCAGCTGGGTGTGGCGGCTCACA No data
Right 1037965835 8:23133463-23133485 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1037965829_1037965835 -8 Left 1037965829 8:23133448-23133470 CCTGTAATCCCAGCACTGTGGGA 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
Right 1037965835 8:23133463-23133485 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037965835 Original CRISPR CTGTGGGAGGCCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr