ID: 1037969701

View in Genome Browser
Species Human (GRCh38)
Location 8:23163551-23163573
Sequence CGCCGCACGGGACAGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037969686_1037969701 28 Left 1037969686 8:23163500-23163522 CCTCCCTCCGCTGATTCTGGAAC 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG No data
1037969688_1037969701 24 Left 1037969688 8:23163504-23163526 CCTCCGCTGATTCTGGAACTTCC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG No data
1037969687_1037969701 25 Left 1037969687 8:23163503-23163525 CCCTCCGCTGATTCTGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 130
Right 1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG No data
1037969694_1037969701 3 Left 1037969694 8:23163525-23163547 CCTCTGGGGCAGCTCAGTGCGGT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG No data
1037969689_1037969701 21 Left 1037969689 8:23163507-23163529 CCGCTGATTCTGGAACTTCCTCT 0: 1
1: 0
2: 1
3: 26
4: 253
Right 1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG No data
1037969685_1037969701 29 Left 1037969685 8:23163499-23163521 CCCTCCCTCCGCTGATTCTGGAA 0: 1
1: 0
2: 1
3: 12
4: 228
Right 1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037969701 Original CRISPR CGCCGCACGGGACAGCCAGG GGG Intronic
No off target data available for this crispr