ID: 1037973660

View in Genome Browser
Species Human (GRCh38)
Location 8:23193090-23193112
Sequence GGGTGCTGCAGTGGAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 1, 2: 13, 3: 115, 4: 629}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037973660_1037973666 19 Left 1037973660 8:23193090-23193112 CCATCTCTTCCACTGCAGCACCC 0: 1
1: 1
2: 13
3: 115
4: 629
Right 1037973666 8:23193132-23193154 ATACTCATCATCTCAGTGACTGG No data
1037973660_1037973662 -6 Left 1037973660 8:23193090-23193112 CCATCTCTTCCACTGCAGCACCC 0: 1
1: 1
2: 13
3: 115
4: 629
Right 1037973662 8:23193107-23193129 GCACCCTATTAAAGCCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037973660 Original CRISPR GGGTGCTGCAGTGGAAGAGA TGG (reversed) Intronic
900098063 1:948415-948437 GGGTGCTGAGGTGGATGGGAGGG - Intronic
900405415 1:2490806-2490828 GGGGGCTGCACTGGCAGGGAAGG + Intronic
900539870 1:3197279-3197301 GGGAGCTGCAGGGGCAGAAAGGG - Intronic
900736436 1:4302294-4302316 GGGTGCTGCAGGGGACGTGGAGG - Intergenic
901851622 1:12019631-12019653 GGGGGCCGCAGTGGAAAAGAAGG + Intronic
902040732 1:13490540-13490562 GGGAGCAGCAGTGGCAGTGATGG - Intronic
902547232 1:17197738-17197760 GGGTGCTGGAGGGGAAAAGGTGG + Intergenic
903166013 1:21520970-21520992 GGTTGCTGCAGGGGAGGGGATGG - Intronic
903285606 1:22275008-22275030 GGCTGCTGCTTTAGAAGAGAGGG + Intergenic
903627923 1:24744918-24744940 GGGTGCTGCAGCGGGGGAGTGGG + Intergenic
904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG + Intergenic
905423766 1:37866826-37866848 GTGTCCTGCAGTGGTATAGAGGG + Intronic
906160220 1:43642604-43642626 GGGTGATGGAGTGGAGGTGAAGG + Intergenic
906934324 1:50198760-50198782 GGGTGGGGCAGTGGAGGAGGTGG - Intronic
907345365 1:53773792-53773814 GGGTGCTGCACTAAAGGAGAGGG - Intronic
907730015 1:57056995-57057017 GAGTACTGGAGTGGAAGAAAAGG + Intronic
907844234 1:58189555-58189577 GGATGCTGGGGTGGAACAGAGGG - Intronic
908633273 1:66133955-66133977 TCTTGCTTCAGTGGAAGAGAAGG + Intronic
908781194 1:67692077-67692099 GGGTGATGGAGTGGGAAAGATGG + Intergenic
909872048 1:80753071-80753093 GGGAGCTACAGTTGAAGATAAGG + Intergenic
911425943 1:97712686-97712708 TGGTTCTGCAGTGGGAGAGAGGG - Intronic
912471495 1:109910272-109910294 GGGGGCTGCAGAGGAAGAAGGGG + Intronic
912547343 1:110460470-110460492 GGGAGCTGAAGTGGAAAAGATGG + Intergenic
912947795 1:114099038-114099060 TGGTGCTGGAGTGGGAGTGAGGG + Intronic
913147251 1:116004164-116004186 GGGTGCTGCAGCCAAAGAGATGG - Intronic
913597738 1:120394416-120394438 GGGTGGCGAAGGGGAAGAGAGGG + Intergenic
913607301 1:120477799-120477821 GGGTGCTGCAGCTGAGTAGACGG + Intergenic
914000427 1:143690073-143690095 GTGTGCTGCAGCTGAGGAGACGG - Intergenic
914089595 1:144484898-144484920 GGGTGGCGAAGGGGAAGAGAGGG - Intergenic
914197724 1:145458172-145458194 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914234611 1:145797259-145797281 GGGTGCTGTAGCTGAGGAGAGGG - Intronic
914309018 1:146449318-146449340 GGGTGGCGAAGGGGAAGAGAGGG + Intergenic
914319474 1:146545222-146545244 AGATGCTGCAGTTGGAGAGAGGG + Intergenic
914476828 1:148031283-148031305 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914503389 1:148266560-148266582 GGGTGTTGCAGCTGAGGAGATGG + Intergenic
914510373 1:148327368-148327390 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914593095 1:149123813-149123835 GGGTGGCGAAGGGGAAGAGAGGG - Intergenic
914718062 1:150267865-150267887 GGGTGCTGGTTTGGAAGAGGAGG - Intronic
915315910 1:155029185-155029207 GGGGGCTGCAGTGGGTGAGTGGG + Intronic
916900301 1:169215119-169215141 GGGAGCTGGAGGGGAAGGGAAGG + Intronic
917970222 1:180201445-180201467 GGGTGTTGAAGGGGAAGAGGAGG - Exonic
918362706 1:183775110-183775132 GGGTGCTGCAGCTGAGGAGATGG - Intronic
919280876 1:195486418-195486440 GGGTGCTATAGTAGAGGAGATGG + Intergenic
920280184 1:204837400-204837422 GGCTGCAGCAGTGGAAGAAGCGG + Intronic
920431792 1:205923497-205923519 GGGTGGTGCAGAGCAAAAGAAGG + Intronic
920550882 1:206859751-206859773 TAGTGCTCCAGTGGAACAGATGG - Intergenic
920986707 1:210897525-210897547 TGGAGCTGCTGTGGAACAGAGGG - Intronic
921684173 1:218070894-218070916 GGGTGGTGGAGGAGAAGAGAAGG + Intergenic
921724125 1:218505798-218505820 GGGTGCTGCAGCTGAGGAAATGG + Intergenic
922009169 1:221563800-221563822 GGAAGCAGCCGTGGAAGAGACGG + Intergenic
922058588 1:222065400-222065422 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
922181906 1:223242464-223242486 GGGTGGGGCAGTGGAGGAGTTGG - Intronic
922449263 1:225723584-225723606 GGGTGCTACAGCCGAGGAGATGG - Intergenic
922507193 1:226133428-226133450 GGTTCCTGTCGTGGAAGAGAGGG + Intergenic
922545473 1:226453466-226453488 TTGGGCTGCAGGGGAAGAGAGGG + Intergenic
922664391 1:227456222-227456244 GGCTGCTGCAATGGAAGAGCTGG - Intergenic
923496659 1:234531458-234531480 GGGAGCTGCAGGGGCACAGACGG - Intergenic
923554944 1:234993156-234993178 GGGTGCTGCAGGGCAGGAGCAGG + Intergenic
923767449 1:236905566-236905588 GGGTGCTGAAGTGAAGAAGATGG + Intergenic
924080619 1:240393946-240393968 GGGTGCTGCAGCCGAGGCGATGG + Intronic
924320483 1:242843671-242843693 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
924333832 1:242967081-242967103 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
924775941 1:247114545-247114567 GGCAGCTGCAGTGCAGGAGAGGG - Intergenic
1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1063665438 10:8058010-8058032 GGTTGCTGCAGAGGGGGAGAAGG - Intronic
1065215155 10:23440504-23440526 GGGGGCTGAAGTGGTCGAGATGG - Exonic
1065707803 10:28487366-28487388 GGGTGCTGCAGTCAAGGAGATGG - Intergenic
1065835773 10:29656760-29656782 GGGTGCTGCAGCCGAGGAGATGG - Intronic
1065837947 10:29676182-29676204 AGGTGCTGCAGGTGAGGAGATGG - Intronic
1065983259 10:30924275-30924297 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1066033932 10:31461186-31461208 GGGAGGAGCAGTGAAAGAGAAGG + Exonic
1066279244 10:33898963-33898985 GGGTGCTGCAGCTGAGGAGCTGG - Intergenic
1066439145 10:35421274-35421296 GGGAGCTCATGTGGAAGAGAAGG - Intronic
1067008876 10:42691323-42691345 GGGTGCTGCAGTGTTCGAGGTGG - Intergenic
1067131526 10:43569630-43569652 GGATGCTCCAGTGGATTAGATGG - Intronic
1067238474 10:44471212-44471234 GGGGGGTGCAGTGGAGGTGAAGG - Intergenic
1067453319 10:46395944-46395966 CAGTGCTGCAATGGAAGAAAAGG - Intergenic
1067583915 10:47463822-47463844 CAGTGCTGCAATGGAAGAAAAGG + Intronic
1068212035 10:53932839-53932861 GGGTGCTGCAGCTGAGGACATGG + Intronic
1069088975 10:64176392-64176414 GGGTGCTGCAGACAAGGAGATGG + Intergenic
1069603091 10:69721889-69721911 GGTTTCTGGAGGGGAAGAGAAGG - Intergenic
1069881507 10:71596597-71596619 GGGTCCTGGCGTGGAAGGGAAGG - Intronic
1069947343 10:71997142-71997164 GGGTTCTGCAGTGGAAGAGTGGG - Intronic
1070706184 10:78640556-78640578 TGGCACTGCAGGGGAAGAGAAGG + Intergenic
1070784420 10:79154698-79154720 GGCTGCTTCTGTGGAAGAGGAGG + Intronic
1070973693 10:80588134-80588156 AGGTGCTGCAGCTGAGGAGATGG + Intronic
1071056211 10:81510771-81510793 GGGTGCTGCAGGTGAGGAGATGG - Intergenic
1071073517 10:81724712-81724734 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1071403611 10:85304865-85304887 GGATGCTGCAGCTGAAGAGACGG - Intergenic
1071526482 10:86362631-86362653 GGGTGCAGCAGAGGAAGGAAAGG - Intronic
1071755742 10:88536777-88536799 GGGTGCTGCTGTGAAGGATAGGG - Intronic
1072728224 10:97827884-97827906 CGGGGCTCCTGTGGAAGAGACGG - Intergenic
1072877045 10:99183637-99183659 GGGTGCTGCAGTTGAGGAGATGG - Intronic
1073260379 10:102185449-102185471 GGGTGCTGCAGCTGAGAAGATGG - Intergenic
1074223105 10:111457975-111457997 GGGTGGGTCAGTGGAAGACAAGG + Intergenic
1074448794 10:113542099-113542121 GAGTGCTGCAGAGGCAGAGTGGG - Intergenic
1075177454 10:120178805-120178827 GCCTTCGGCAGTGGAAGAGAAGG + Intergenic
1075307898 10:121384146-121384168 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1075950150 10:126470116-126470138 GTGTCCTGCAGTGGAGGAAAAGG + Intronic
1075950155 10:126470155-126470177 GCATGCTGCAGAGGGAGAGAAGG + Intronic
1076325337 10:129616393-129616415 TGGTGCTGAAGGGGAAGCGAGGG + Intronic
1076738615 10:132469561-132469583 GGGGGCTGGAGGGGAAGAGCAGG + Intergenic
1077024575 11:433530-433552 GGGTTCTGAGGTGGAATAGAGGG - Intronic
1077293168 11:1809723-1809745 GGGTGCTGCAGCTGAGGTGATGG + Intergenic
1077555446 11:3223911-3223933 AGATGCTGCCGTTGAAGAGATGG + Intergenic
1077572964 11:3355131-3355153 TGGTGCTGGAGGGGATGAGAGGG + Intronic
1077913284 11:6593145-6593167 GGGAGTTGCAGGGGGAGAGATGG - Intronic
1078473508 11:11610842-11610864 AGGAGCTGCAGAGGAAGGGAGGG - Intronic
1078516428 11:12026592-12026614 GGGTGCTGCAGCTGAGGATATGG + Intergenic
1078579507 11:12527519-12527541 TGGGGCTGCAGTGGAAGACCAGG - Intronic
1079723356 11:23847255-23847277 GGGTGCTGCAGCAAAAGAGATGG - Intergenic
1080001429 11:27354762-27354784 GGAAGCTGAAGTGGAAGAGGAGG + Intronic
1080582511 11:33655833-33655855 GGGAGGTGCAGTAGAAGAGATGG + Intronic
1080599398 11:33807756-33807778 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1081130561 11:39373829-39373851 GGGTGCTACAGCTGAGGAGATGG - Intergenic
1081173283 11:39894072-39894094 GGGGGCAGCAGTGGGCGAGAGGG - Intergenic
1081317000 11:41641986-41642008 GGGTGCAGCAGTGGCAGTGGTGG - Intergenic
1081773106 11:45661813-45661835 GAGGGCTGCAGTGAGAGAGAAGG + Intronic
1082098672 11:48153134-48153156 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1083538711 11:63495645-63495667 GGGTACTGCAGTGGGAGGGAGGG + Intergenic
1084083949 11:66846153-66846175 GGGTACTGCAGGGGAAGGGCTGG + Exonic
1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG + Intronic
1084904254 11:72333947-72333969 ATGAGCTGCAGTGGAAGGGAGGG + Intronic
1085449946 11:76625705-76625727 GAGAGCTGCAGAGGAAGAGGGGG + Intergenic
1085633948 11:78143460-78143482 AGGTGCTGCAGAGAAACAGATGG + Intergenic
1086043442 11:82505658-82505680 GGGGGCTGCAGTCAAGGAGATGG + Intergenic
1086750115 11:90482321-90482343 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1087067861 11:94044307-94044329 GGGTGGTGCAATAGAAGAAAAGG - Intronic
1088469588 11:110178247-110178269 GAGTTCTGCACTAGAAGAGAGGG - Intronic
1089297820 11:117480575-117480597 GGGTGCGGCAGTGGAGGGGAGGG + Intronic
1089622471 11:119729544-119729566 GGGGGCGGCGGTGGAGGAGAGGG + Intergenic
1090866504 11:130705378-130705400 GGGTGATGCAGTAGAAGCCAAGG - Intronic
1091205790 11:133820080-133820102 TGGAGCTGCAGTGAAACAGATGG - Intergenic
1091877674 12:3949733-3949755 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1092128159 12:6089816-6089838 GGGTGCTTCAGTGGGTGAGGTGG - Intronic
1092627451 12:10342246-10342268 GGGTGCCGCAGCTGAGGAGATGG - Intergenic
1093930449 12:24950230-24950252 GTGGCCTGCCGTGGAAGAGAGGG + Intergenic
1094569888 12:31632375-31632397 GGGAGTTGCAGTGGAGGAGTTGG - Intergenic
1094598517 12:31887596-31887618 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1095658096 12:44695078-44695100 GGGAGGGGCAGAGGAAGAGAGGG + Intronic
1095923346 12:47553379-47553401 GGGTGCTGCAGCTGAGGGGATGG - Intergenic
1095950900 12:47781391-47781413 AGGGGCTGGAGTGGGAGAGAAGG - Exonic
1096079997 12:48826896-48826918 GGCTGCGGCAGTGATAGAGATGG + Intronic
1096605610 12:52763384-52763406 GGATGCAGCAGCGGAAGTGACGG + Intergenic
1097364615 12:58698053-58698075 GGGTAGTGGAGAGGAAGAGATGG - Intronic
1098038338 12:66329386-66329408 GGGTGCTGGAGAGTAATAGATGG + Intronic
1098435481 12:70464156-70464178 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1099065978 12:77979915-77979937 GGGTGCTGCAGCTGAGGAGAAGG + Intronic
1100705073 12:97191698-97191720 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1101022799 12:100571099-100571121 AGGTGCTGCAGCTGAAAAGATGG + Intergenic
1101254827 12:102966513-102966535 GGGTGGTGGAGTGGAGGAGGGGG - Intergenic
1102031551 12:109742966-109742988 GGGTGTTGAAGGGGAAGAAAGGG - Intronic
1102082762 12:110111838-110111860 GGGTGCTGCAGCTGAAGTGATGG - Intergenic
1102444869 12:112994275-112994297 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1102880127 12:116478433-116478455 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1103615179 12:122147375-122147397 TGTTGCAGCAGTGGAAGAGATGG + Intergenic
1104120102 12:125790796-125790818 GGTTGCTGCAGCTGAGGAGATGG - Intergenic
1104125386 12:125841202-125841224 AGATGCTGCAGTGGAGGAGATGG + Intergenic
1104530501 12:129565699-129565721 GGGAGCTGCAGTAGCAGCGAGGG - Intronic
1104611067 12:130228231-130228253 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1105577621 13:21668847-21668869 CGTTGCAGCAGTGGAAGAGAGGG - Intergenic
1105730890 13:23214300-23214322 GGGTGCTGCAGTCTGGGAGATGG - Intronic
1105929757 13:25041496-25041518 GGCTGCAGGAGAGGAAGAGAAGG - Intergenic
1106462769 13:29987768-29987790 GGGTGTTCCAGGAGAAGAGAAGG - Intergenic
1106707264 13:32294477-32294499 GGCTGCTTCAGTGGACGTGAAGG - Exonic
1107868075 13:44723050-44723072 GGGAGATGCAGGGGAAGACAGGG - Intergenic
1108076878 13:46690304-46690326 CCGTGCTTCAGTGGGAGAGAGGG + Intronic
1108189934 13:47927845-47927867 GGGTGCTGAGGGAGAAGAGATGG - Intergenic
1108372726 13:49787026-49787048 GGGTGAAGGAGGGGAAGAGAAGG + Intronic
1108589129 13:51896642-51896664 GGGTGCCTCATGGGAAGAGATGG - Intergenic
1108751280 13:53450673-53450695 GTGTGCTGCAGCGAAGGAGATGG - Intergenic
1108752051 13:53457772-53457794 GGGTGCTGCAGTTGAGAGGATGG + Intergenic
1108855621 13:54789379-54789401 AGGTGCTGCAGCTGAGGAGACGG + Intergenic
1109119029 13:58430102-58430124 GGGTGCTCCAGTTGAGAAGATGG + Intergenic
1109292034 13:60488118-60488140 GGGTGCTACAGCTGAAGAGATGG + Intronic
1109428824 13:62205166-62205188 GGATGCTGCAGCTGAAGAGATGG + Intergenic
1109912290 13:68930462-68930484 GGGTGCTGTAGCAGAGGAGAAGG + Intergenic
1110458731 13:75719614-75719636 GGGTCCTACCGTGGCAGAGAAGG - Intronic
1111352432 13:87048725-87048747 TGGTGCTGCAGCTGAGGAGATGG + Intergenic
1111430385 13:88142377-88142399 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1111462040 13:88558178-88558200 TGGTGATGCAGTTGAGGAGATGG + Intergenic
1111488582 13:88938410-88938432 GGATGCTGCAGCGGAGGAGATGG - Intergenic
1111519543 13:89382641-89382663 GGGTGGGGCAGGGGAAGAAATGG - Intergenic
1111592452 13:90367765-90367787 GGGTTCTGCAGCTGAGGAGATGG - Intergenic
1112921140 13:104614304-104614326 GGGTGCTGCAGCTAAAGAGATGG - Intergenic
1112938237 13:104827459-104827481 CTGTGCTGTAGGGGAAGAGATGG + Intergenic
1112969086 13:105237129-105237151 GGGTGCAGAAATGGTAGAGATGG + Intergenic
1113263028 13:108587047-108587069 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1113601708 13:111574008-111574030 GGGTGCTGCAGCTGAGGAGACGG + Intergenic
1114610616 14:24037694-24037716 GGCTTGTGCAGGGGAAGAGATGG - Intergenic
1114653368 14:24300634-24300656 GAGTGCTGCAGAGGAGGAGGAGG + Exonic
1115596333 14:34913083-34913105 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1116147554 14:41094859-41094881 AAATGCTGCAGTGGAACAGAGGG + Intergenic
1116389401 14:44375072-44375094 GGGTGCTGCAGTCAAGCAGATGG - Intergenic
1118380079 14:65210408-65210430 GGGTGCTGCAGCTGGGGAGATGG - Intergenic
1118723009 14:68607795-68607817 GGGTGCTGGGGAGGAAGACAGGG + Intronic
1119621377 14:76134392-76134414 CAGTGGTGCAGTGGGAGAGATGG - Intergenic
1119882572 14:78112728-78112750 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1120313829 14:82866252-82866274 GTGTGCAGGAGTGGGAGAGAGGG + Intergenic
1120313851 14:82866437-82866459 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1120526110 14:85578972-85578994 GGGTGCTGGGGTGGATCAGAAGG - Intronic
1121037188 14:90716083-90716105 GGGTCTTGCAGTGGGAGGGAAGG + Intronic
1121124250 14:91395766-91395788 GTGTTCTGTAGGGGAAGAGATGG - Intronic
1121250480 14:92496063-92496085 GGGTTCTGCTGAGGAAGAGGAGG - Exonic
1121467715 14:94126754-94126776 GGGTGCTACAGTGGATGGGAGGG - Intergenic
1121774530 14:96582073-96582095 GTTTGCTGCTCTGGAAGAGAAGG + Intergenic
1122000083 14:98640707-98640729 GGGTGCTGCAGTCGAGGAGGTGG - Intergenic
1122163431 14:99802918-99802940 GGGTGCTAAAGTGGGAGGGAGGG - Intronic
1122176035 14:99919875-99919897 GGGGGCTCCTGTGGAAGACAAGG + Intronic
1122532816 14:102440647-102440669 GGGTGCAGCAGAGGCAGTGACGG - Intronic
1122919641 14:104874716-104874738 GGGTACTGCAGTGGAGGACCAGG - Intronic
1123071336 14:105643942-105643964 AGGTGGTGCTGAGGAAGAGATGG + Intergenic
1123813964 15:23957687-23957709 GGGTGCTGCAGTCAAGGGGATGG + Intergenic
1124013794 15:25860221-25860243 GGGTGCTGCAGTGAGAGATCGGG - Intronic
1124062262 15:26305427-26305449 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124062838 15:26310653-26310675 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124368648 15:29090998-29091020 GGGTACTGCATTGGGATAGATGG + Intronic
1124372701 15:29112399-29112421 GGGTGCTGGTGTGTAGGAGACGG + Intronic
1124475104 15:30026336-30026358 GGGTTCTGCAGCAGAGGAGATGG + Intergenic
1124486250 15:30119777-30119799 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1124541324 15:30588762-30588784 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1124555299 15:30719556-30719578 GGCTGCTGCTGTGCAGGAGAAGG - Intronic
1124757334 15:32418825-32418847 GGGTGCTGCAGCTAAGGAGATGG - Intergenic
1125365878 15:38915440-38915462 GGGTGCTGCAGCTGAGGAAATGG - Intergenic
1125936287 15:43639122-43639144 GGGTTCAGCAGTGCAAGAGAGGG - Intronic
1125949055 15:43735641-43735663 GGGTTCAGCAGTGCAAGAGAGGG - Intergenic
1126522710 15:49614908-49614930 GGGTGCTGCAGCCGAGGAGATGG - Intronic
1126939394 15:53749906-53749928 GGAAGCTGCAGTGGAAAAGCTGG + Intronic
1127530285 15:59837028-59837050 GGCTGGTGAAGTGGAGGAGAGGG + Intergenic
1127980270 15:64029814-64029836 GGGTGCTGCTGTGGTGGAGGAGG + Intronic
1128811073 15:70573159-70573181 GGGGAATGGAGTGGAAGAGAAGG + Intergenic
1129104051 15:73293433-73293455 GGCTGCTGGAGTGGAAATGATGG - Exonic
1129389501 15:75213604-75213626 GACTGGTGCAGGGGAAGAGAGGG - Intergenic
1129751118 15:78065142-78065164 GGGTGCTTGAGTGTTAGAGATGG - Intronic
1131070500 15:89462711-89462733 GGTTGCTGGAGGGGAAGAGTAGG - Intergenic
1132017967 15:98335825-98335847 GGGTGCTGCGGCCGAGGAGATGG - Intergenic
1132484811 16:185300-185322 TGGTACTGCAGTGGAAAGGAAGG + Intergenic
1132586569 16:708137-708159 GGGTGCTCCAGGTGAAGGGAGGG - Intronic
1132689841 16:1177545-1177567 GGGTGTTGGGGTGGAAGGGAAGG + Intronic
1132845770 16:2000166-2000188 GGTTGCTGCAGTGGAGCAGGAGG + Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133212819 16:4272611-4272633 GGGGGCTGCAGTGGTAGGAAGGG + Intronic
1133309295 16:4833119-4833141 GGTTGCTGCAGTGGTGGTGATGG - Intronic
1133479372 16:6155215-6155237 GGATGCCCCAGAGGAAGAGATGG - Intronic
1133681894 16:8127383-8127405 GGGAGTTGCAGGGGAAGGGAGGG + Intergenic
1133886158 16:9829648-9829670 GGGTGCTGCAGAAGATGAAAAGG + Exonic
1133893938 16:9907806-9907828 TGGAGCTGCAGAGGAAGTGAGGG - Intronic
1134355255 16:13476390-13476412 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1134597386 16:15506805-15506827 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1134888426 16:17816302-17816324 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1136345722 16:29674465-29674487 GGGTGCTGCAGGAGTGGAGAAGG - Intronic
1137504106 16:49036042-49036064 TCCTGCTGCAGTGGAAGAAAAGG - Intergenic
1137540280 16:49357063-49357085 TGGGGCTGCAGAGGAAGGGAGGG - Intergenic
1137867477 16:51915621-51915643 TGGTGCTCCAGAGGAAGTGATGG - Intergenic
1137889670 16:52145938-52145960 GGGTGCTGTAGAGATAGAGAAGG - Intergenic
1138299845 16:55916837-55916859 AGCAGCTGGAGTGGAAGAGAAGG - Intronic
1138864483 16:60799812-60799834 TGATGCTGGAGAGGAAGAGAAGG + Intergenic
1140014049 16:71164859-71164881 AGATGCTGCAGTTGGAGAGAGGG - Intronic
1140019729 16:71226924-71226946 GGGTGCTGCAGCTGTGGAGATGG - Intronic
1140450692 16:75068659-75068681 AGCTGCTGCAGTGGATGAGCAGG + Intronic
1140746955 16:77988922-77988944 GGGCGCAACAGTGGAAGAGGTGG + Intergenic
1141132084 16:81444184-81444206 GGGTCCCGCAGTGGGAGACAGGG + Intergenic
1141456205 16:84144480-84144502 GGGTGCTGGAGGGGAAGGGCTGG - Intronic
1141460708 16:84177177-84177199 GGTTCCTAGAGTGGAAGAGAAGG - Intronic
1141825300 16:86474805-86474827 GGTTGCTGGGGTTGAAGAGAGGG + Intergenic
1142115103 16:88352419-88352441 GGGTGCTGCAGGTGCACAGAGGG + Intergenic
1142226023 16:88877994-88878016 TGCTGCTGCAGTGGCAGTGAGGG - Intronic
1142717818 17:1756635-1756657 GGGAGCTGCAGTGGAGAGGAGGG - Intergenic
1143155231 17:4832582-4832604 GGGTGGCGAAGGGGAAGAGAGGG - Intergenic
1143463710 17:7121391-7121413 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1143501507 17:7342114-7342136 AGGTGATGCTGTGGAAGAGGAGG + Intronic
1144029083 17:11303902-11303924 GGGTACAGCAGTGGAAGGGCAGG + Intronic
1145017323 17:19407813-19407835 GGGTGCTGCTGGGGAAGTCAAGG - Intergenic
1145183445 17:20773283-20773305 GGGTGCTGCAGTAGAGGAATTGG - Intergenic
1146162150 17:30565849-30565871 GGGTCCTGCAGAGAAACAGAGGG + Intergenic
1146295480 17:31646705-31646727 GGGTGCTGCAGCAGAGGAGATGG + Intergenic
1146931088 17:36778522-36778544 GTGTGCTGAAGTGGAATAGGCGG + Intergenic
1147502641 17:40980365-40980387 GGGTGGTGCAGTGAAGGATAAGG + Intronic
1149465694 17:56877317-56877339 GTCTGCTGCAGGGAAAGAGAAGG - Intergenic
1150204232 17:63389516-63389538 TGGTGCTGCTGTGCAAGAAACGG + Exonic
1150542354 17:66115769-66115791 GGGTGCTGCAGCCAAGGAGATGG - Intronic
1150551487 17:66214859-66214881 GGCTACTGTAGGGGAAGAGAAGG - Intronic
1151574746 17:74947115-74947137 GGGTGCTGCACTGGGCCAGATGG + Exonic
1152135596 17:78501460-78501482 GGGTGCTGGAGGGGGAAAGAGGG - Intronic
1152185294 17:78852487-78852509 GTGCGATGCAGTGGCAGAGACGG - Intergenic
1152228411 17:79103068-79103090 GGGTGCGGCAGTGGCAGGGCTGG + Intronic
1152717562 17:81907253-81907275 GGGGGCTACAATGGGAGAGAGGG + Exonic
1153343463 18:4001733-4001755 GGGTTTTGCTGTGGAGGAGATGG + Intronic
1154172608 18:12062115-12062137 GGGTGCCTCAGTGGAAGCGAGGG + Intergenic
1154295530 18:13143681-13143703 GGGTGCTGCAGCTGAAGAGATGG + Intergenic
1155433969 18:25792113-25792135 GGAATCAGCAGTGGAAGAGAGGG - Intergenic
1155790848 18:29968843-29968865 GGATGCTGCAGCTGAGGAGATGG + Intergenic
1156105017 18:33649313-33649335 GGGTGTTTCAGTAGAAGTGAAGG + Intronic
1156645681 18:39159631-39159653 GGGTGCTGCAGCTGAGGAGAAGG + Intergenic
1156695404 18:39760488-39760510 GGGACCTGCAGTGAAAGAGGTGG + Intergenic
1156745117 18:40381039-40381061 GTGTGCTGATGTGCAAGAGAAGG + Intergenic
1157183596 18:45519464-45519486 GGGTGCTGAAGTGGGAAAGGAGG - Intronic
1159105103 18:63995832-63995854 GGGTGCTACAGCTGAGGAGATGG + Intronic
1159115116 18:64104993-64105015 GGGTGCTGAAGTAGTAAAGAAGG - Intergenic
1159217114 18:65407555-65407577 AGGTGCTGCAGTCGAGGAGGTGG + Intergenic
1159333892 18:67038533-67038555 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1159433960 18:68391773-68391795 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1159453132 18:68627477-68627499 GGTTTCTGCAGGTGAAGAGAAGG + Intergenic
1159590100 18:70324976-70324998 GGGTGCTGAGGAGGAGGAGAAGG - Exonic
1159669907 18:71210578-71210600 GGGTGCTGCAGCTGAGGAGACGG - Intergenic
1160186470 18:76680196-76680218 GGCGGCTGCAGTGGATGAGACGG + Intergenic
1160389785 18:78521469-78521491 GGGTGCTGCTGAGGCAGAGAAGG + Intergenic
1160711034 19:551011-551033 GGGTGCTGGGGTGATAGAGATGG - Intergenic
1160901314 19:1430099-1430121 GAGTGCTGGAGAGGAAGAGAGGG + Intronic
1161436619 19:4267512-4267534 CAGTGCAGCAGTGGAAGAGTGGG + Intronic
1161509087 19:4660746-4660768 GGGGCCTGCAGAGGAAGAGGGGG + Exonic
1161576590 19:5057957-5057979 GGGTGCTGCTGTGTAGGTGAGGG + Intronic
1161683194 19:5690712-5690734 GGGGGCTTGAATGGAAGAGATGG + Intronic
1161768857 19:6220782-6220804 GGTTGCTGCACAGGCAGAGAAGG + Intronic
1161832944 19:6623049-6623071 GGGTGCTGCAGCTGAGGAGGTGG + Intergenic
1162800057 19:13105230-13105252 GTGTCCTGCAGTGGAGGAAAGGG + Intronic
1163207494 19:15814342-15814364 GGTGGCTTAAGTGGAAGAGAGGG - Intergenic
1163811044 19:19431868-19431890 GGGTGGTGCTGTGGAAGAAGAGG + Intronic
1164866095 19:31605642-31605664 GGGTGTTGCAATTGCAGAGAGGG + Intergenic
1165308904 19:35018997-35019019 GGCTGCAGCAGTGGAGGAGATGG + Intronic
1165384981 19:35505128-35505150 GGGGGCTGGAGTGGAAGGGAGGG - Intronic
1165610402 19:37146627-37146649 GGCTGCTCCAGTGGAGGAGGTGG + Intronic
1166690533 19:44819468-44819490 CGGTGCCGAAGTGGAAGACATGG - Exonic
1166886053 19:45961548-45961570 GGAGGCTGCAGTGTCAGAGAGGG + Intronic
1167203965 19:48087321-48087343 GCCTGTGGCAGTGGAAGAGAGGG - Intronic
1167240022 19:48338207-48338229 GGGAGCTGCAGAGGAGGAGACGG - Intronic
1167254029 19:48416395-48416417 GGAAGCTGCAGTGCAAGAGAAGG - Intronic
1167449887 19:49560810-49560832 GGGGGGTGAGGTGGAAGAGAGGG + Intronic
1167537821 19:50066191-50066213 GGGTGAGGCAGTGGAACACACGG - Intergenic
1167647816 19:50715354-50715376 GGGGGAGGCAGGGGAAGAGAAGG + Intronic
1168408296 19:56121725-56121747 GGGAGGTGCAGCGGCAGAGAAGG - Intergenic
925931003 2:8707886-8707908 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
926761899 2:16285460-16285482 GGGTGCTGCCTGGGAGGAGAGGG + Intergenic
927642087 2:24851955-24851977 GGGTGCTGCGGTAGAGGATATGG - Intronic
927645943 2:24877073-24877095 GGGTGCAGCAGTACAAGTGATGG - Intronic
928002601 2:27537931-27537953 GTGTGCTTCAGAGGAAGAGTGGG + Intronic
928010162 2:27599887-27599909 GGGTGTTGAAGAGGAGGAGAGGG + Intronic
928085673 2:28344991-28345013 GGGTGCTGGAGTGGGATAGCGGG - Intergenic
928834773 2:35530309-35530331 AGGTGCTGCAGTCAAGGAGATGG + Intergenic
928838737 2:35579693-35579715 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
929035355 2:37685907-37685929 GGGAGGTGCAGTGGGGGAGAAGG + Intronic
929397119 2:41535749-41535771 GGGTGCTGCAGCCAAAGAGATGG - Intergenic
929490588 2:42392592-42392614 GGGTGCTACAGCCAAAGAGATGG + Intronic
929998481 2:46845187-46845209 TGGAGCAGCAGTTGAAGAGAGGG + Intronic
930086328 2:47500027-47500049 GGGTGCTGCAGCCAAGGAGATGG - Intronic
930411731 2:51032697-51032719 GGGTCCAGCAGTCAAAGAGAAGG + Intergenic
930687005 2:54320167-54320189 GTGGGCTGGAGAGGAAGAGAGGG + Intergenic
931946312 2:67312480-67312502 GGGTTCTGCACTGGATGACAGGG + Intergenic
931964484 2:67518236-67518258 GGGTGCTACAGCTGAGGAGATGG + Intergenic
932734621 2:74246045-74246067 GGGTGCTGCAGAGCAGGAGCAGG - Intronic
933453570 2:82491632-82491654 GGGTGCTGCAGCAGAGGAGATGG + Intergenic
933463622 2:82621781-82621803 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
933634640 2:84694115-84694137 GGATGCTGCAAGGGAAGAGCAGG - Intronic
934130751 2:88946485-88946507 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934132768 2:88965448-88965470 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
934140775 2:89045190-89045212 AGGTGCTGCAGCCGAGGAGACGG - Intergenic
934146418 2:89099046-89099068 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934166248 2:89296885-89296907 TTGTGCTGCAGGGGATGAGAAGG + Intergenic
934201026 2:89885571-89885593 TTGTGCTGCAGGGGATGAGAAGG - Intergenic
934222849 2:90101529-90101551 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
934228459 2:90155352-90155374 AGGTGCTGCAGCCGAGGAGACGG + Intergenic
934564102 2:95328953-95328975 GGGAGCTGCAGAGGAGGGGAGGG + Intronic
935198832 2:100838024-100838046 GGGTGCTGCAGAGAATGAGGTGG - Intronic
935296435 2:101653680-101653702 GGGTGCTGCAGCCTAGGAGATGG - Intergenic
935328359 2:101958662-101958684 GGGTGCTGAAGTAGAGGAGGAGG + Intergenic
935765649 2:106365104-106365126 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
935794527 2:106628545-106628567 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
935962221 2:108437015-108437037 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
935962846 2:108444335-108444357 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
936016816 2:108965662-108965684 GACTGCTGCAGTGGGAGAGCTGG + Intronic
936467701 2:112767876-112767898 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
936526015 2:113242126-113242148 GGGGACTGCAGTGGGGGAGAGGG + Exonic
936855846 2:116956377-116956399 TGGTGCTGCAGTAGAGGAGGTGG - Intergenic
937070226 2:119057510-119057532 GGGTGCTGGAGGAGCAGAGAGGG + Intergenic
937468705 2:122157015-122157037 GGGTGCAGCTGTTGAAAAGAGGG + Intergenic
937468865 2:122158225-122158247 CGGTGCTGCATTGGAAGAATGGG + Intergenic
937783248 2:125864623-125864645 AGGTGCTGCAGTAGAGCAGATGG + Intergenic
938308543 2:130270001-130270023 GGGTGCTGCAGAACAAGTGAAGG - Intergenic
938400283 2:130985428-130985450 GGGTGCTGCAGCCGAGGAAATGG + Intronic
938446787 2:131386835-131386857 GGGTGCTGCAGAACAAGTGAAGG + Intergenic
938630902 2:133166073-133166095 GGGCCCTGCAGTGGAAGGAATGG + Intronic
939982277 2:148796008-148796030 GCTTGCTGCAGTGCAAGAGATGG - Intergenic
942659341 2:178247591-178247613 GGGTGCTGTTGTGGCAGTGAAGG - Intronic
943097407 2:183447059-183447081 AGGTGCTGCAGTGTAAGAAGGGG - Intergenic
943157680 2:184204958-184204980 GGGTTCTTCAGTGGAGGAGGGGG + Intergenic
943443970 2:187959850-187959872 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
944511597 2:200471360-200471382 GAGGGCTGAAGTGGAAAAGAGGG - Intronic
944668426 2:201975546-201975568 GGGTGCTGGCGTGGAAGTGGGGG + Intergenic
944780407 2:203011937-203011959 ACGTGCTACAGTGAAAGAGAAGG + Intronic
945366988 2:208966328-208966350 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
946201660 2:218074042-218074064 GGGAGCTGCAGAGGAGGAGAGGG + Intronic
946389487 2:219406917-219406939 GGGATCTGGAGTGGCAGAGAAGG + Intergenic
946404760 2:219486469-219486491 GGGGGCTGCAGTGAGAGAAAAGG + Intronic
947254656 2:228148577-228148599 GGATGCTGGAATGGAAGAGGAGG + Intronic
947312949 2:228823975-228823997 GGGGTCTGCATGGGAAGAGAGGG + Intergenic
947354857 2:229281450-229281472 TGGTGCTGTAGTGGCAGGGATGG - Intergenic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
947788281 2:232844506-232844528 GGATGATGCAGTGAAAGAGGTGG + Exonic
948288945 2:236810044-236810066 AGGTACTGCAGTTGAAGAGATGG - Intergenic
948777905 2:240299403-240299425 GGGTGCTGGAGTGGGAGGCAGGG - Intergenic
948818307 2:240525207-240525229 GGGTGCTGCAGCTGAGGAGCTGG - Intronic
1168768806 20:400641-400663 GGCTGTGGCAGGGGAAGAGAGGG - Intergenic
1169231043 20:3889175-3889197 GGGTTCCGCGGAGGAAGAGAAGG - Exonic
1169318709 20:4613475-4613497 GGGTGGGGCAGAGGGAGAGAAGG + Intergenic
1170473043 20:16687314-16687336 GCATGCTGAAGTGGAAGTGAGGG + Intergenic
1170500789 20:16974220-16974242 GGGAGCAGCAGTGGAAGCGATGG + Intergenic
1170557313 20:17525239-17525261 AAGTGCAGCAGTGGCAGAGATGG + Intronic
1170757089 20:19213622-19213644 AGCTGCTGCTGTGGAAGAAATGG + Intronic
1170928740 20:20749171-20749193 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1171032694 20:21691589-21691611 AGGTGGTGAAGTGGAAAAGAGGG + Intergenic
1171288194 20:23960810-23960832 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1171357306 20:24557953-24557975 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1171466057 20:25328827-25328849 AGGTGCTGCTGTGGAAGAGAAGG - Intronic
1171533603 20:25867846-25867868 GGGTTCTGCTCTGGATGAGAAGG + Intronic
1172628712 20:36363964-36363986 GGGTGCTGCAGGGCCAGGGAGGG + Intronic
1172696301 20:36825502-36825524 GGGTGTGACACTGGAAGAGAGGG + Intronic
1172809528 20:37637326-37637348 GGGGGCTGCAGAGGCAGTGAGGG + Intergenic
1173747390 20:45448353-45448375 GGGTTCTGCTGTGAAGGAGAAGG - Intergenic
1174073798 20:47917838-47917860 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1174173075 20:48628963-48628985 GAGGGCTGCAGAGGAAGAGAGGG + Intronic
1174543054 20:51304757-51304779 TGGTGCAGCAGCAGAAGAGAAGG + Intergenic
1174787732 20:53448187-53448209 GGGTGCTGCAGCTGAGGAAAGGG + Intronic
1174864590 20:54123544-54123566 GGTTCCTTCAGGGGAAGAGAGGG + Intergenic
1175510191 20:59518838-59518860 GGATGCTGCAAAGGAAGAGGAGG - Intergenic
1175891257 20:62317019-62317041 TGATGCTGCAGCGGAAGGGAGGG + Exonic
1175943386 20:62548045-62548067 GGGGGCAGAAGGGGAAGAGAGGG - Intergenic
1176038564 20:63052266-63052288 GGGTCCTGCAGGGGAAGGAAGGG - Intergenic
1176038574 20:63052306-63052328 GGGTCCTGCAGGGGAAGGAAGGG - Intergenic
1176663477 21:9662188-9662210 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1177165218 21:17594292-17594314 GGGTGCCACATTGGAAGAGGTGG + Exonic
1177198862 21:17931079-17931101 GGTTGCTGCAGTTGGAGAGGGGG - Intronic
1177282207 21:18995130-18995152 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1178790064 21:35691608-35691630 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1178835479 21:36093980-36094002 GGGTGCTGCAGCAGAGGAGATGG - Intergenic
1179236508 21:39552021-39552043 GGGTGCTGCAGCCCAGGAGATGG + Intergenic
1179284630 21:39966928-39966950 AGGTGCTGAAGTGGAGGACAAGG - Intergenic
1181330189 22:22084937-22084959 GGGTTATGCAGGGGTAGAGAAGG - Intergenic
1181730005 22:24838298-24838320 GGGTGCTGCAGCTGAAGAGAAGG + Intronic
1182124966 22:27809724-27809746 GTGTGCTCCAGTGTAAGAAATGG + Intergenic
1182774432 22:32820420-32820442 AGGTGCTGCAGTGGAATGGGTGG - Intronic
1183273325 22:36875635-36875657 GTGCCCTGCAGAGGAAGAGAAGG - Exonic
1184130483 22:42514170-42514192 GGGTGCTGGAGAGGGAGAGACGG - Exonic
1184140659 22:42575992-42576014 GGGTGCTGGAGAGGGAGAGACGG - Intergenic
1184329622 22:43819121-43819143 GGACTCTGCAGAGGAAGAGAAGG - Intergenic
1184349736 22:43935830-43935852 GGCTGCTGCAGTAGGAGTGAGGG + Intronic
1184507053 22:44910190-44910212 GGGTGCTGCAGTTGGGGACATGG + Intronic
1184900322 22:47442746-47442768 CAGTGCTGCAGATGAAGAGATGG - Intergenic
1185285201 22:49996941-49996963 AGGTCCTGCAGTGGAGGAGATGG + Intronic
1185352980 22:50347670-50347692 GGGGGCTGCAGTGAAAGGCAGGG - Intronic
949439116 3:4061540-4061562 AGGTGCTGCAGCTGAGGAGATGG - Intronic
949969912 3:9396440-9396462 GGGAGCTGCGGTGGAGGAGGTGG - Intergenic
950204111 3:11064819-11064841 GGGTGCTGCAGCCCAGGAGATGG - Intergenic
950205143 3:11074303-11074325 GGGTGCTGCAGTCCAGGAGATGG - Intergenic
950268941 3:11597735-11597757 GGGTGCTACAGTCCAGGAGATGG - Intronic
950847447 3:16028661-16028683 GGGAGGTGCAGTTGAAGAGAAGG + Intergenic
951744180 3:25959107-25959129 AGGTGCTGGAAAGGAAGAGAAGG - Intergenic
952691928 3:36218704-36218726 TGGTGCTGCAGTGGAAAAGTAGG - Intergenic
952834455 3:37591487-37591509 GGGAGCTGGAGTGATAGAGAAGG + Intronic
953312529 3:41892945-41892967 GGGTGCTGCAGCTAAGGAGATGG - Intronic
953719281 3:45341162-45341184 GGATGCAGAACTGGAAGAGATGG + Intergenic
953804306 3:46054675-46054697 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
954076825 3:48187890-48187912 GGGGGCTGCAGGCGAAGAGCAGG + Exonic
954078272 3:48196934-48196956 GGGGGCTGCATTGGATGAAATGG - Intergenic
954680625 3:52344132-52344154 GGGTGCTGCAGGGGAGGTGCAGG + Intronic
955158204 3:56438419-56438441 AGGTGCTGCAGCTGAGGAGATGG - Intronic
956406936 3:68937675-68937697 AGATGCTGGAGTGGAAGGGATGG - Intergenic
956736730 3:72244208-72244230 GGGTGCTTATGTGGAGGAGAGGG - Intergenic
957592031 3:82211619-82211641 GGGTGCTGTAGCTGAGGAGATGG - Intergenic
957914630 3:86672333-86672355 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
958150177 3:89682791-89682813 GTGTGCAGCAGAGGAGGAGAGGG - Intergenic
959086495 3:101855881-101855903 GGGAGCAGCGGTGGAAGCGAAGG + Exonic
959417794 3:106098399-106098421 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
959487629 3:106945680-106945702 TGCTGCTGCAGAGGAAGAGTGGG - Intergenic
959527837 3:107397646-107397668 GGGTGTTGCTGTGGAGGAGGGGG - Intergenic
959566210 3:107835225-107835247 GGATGCTGCAGTGAACAAGATGG - Intergenic
960060791 3:113317940-113317962 GGGTGAGGGAGTGGGAGAGATGG - Intronic
960130506 3:114051072-114051094 GGTTGCTGAAGTGGAATTGAGGG - Intronic
960820641 3:121727011-121727033 GAGTTCTACAGAGGAAGAGATGG - Exonic
961991874 3:131200787-131200809 GGGTGCTGCAGCCAAAAAGATGG - Intronic
962009363 3:131379427-131379449 GGGTGGGGCAGAGGCAGAGAAGG + Intergenic
963743758 3:149105618-149105640 CAGTGCTGCAGTGGAAGAGATGG + Intergenic
963773490 3:149414717-149414739 GGGTGCTTCTGTGGAAGGCAAGG + Intergenic
964378230 3:156070707-156070729 GGGTGCTGCAGTCGAGGAGATGG + Intronic
964445244 3:156751453-156751475 GGGTTCGGCATTGAAAGAGAGGG - Intergenic
964720886 3:159765909-159765931 GGGTGCTGGAGTGGAAAAGAGGG + Intronic
965015882 3:163156054-163156076 GGGTGCTGCAGCCGAGGAGATGG + Intergenic
965952644 3:174329655-174329677 GAGAACTGCAGCGGAAGAGATGG + Intergenic
965984318 3:174733717-174733739 GGGTGCTGCAGCTGAGGAGATGG + Intronic
967162135 3:186748237-186748259 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
967590778 3:191271398-191271420 GGGTGCTGCAGCTGAGGAGATGG - Intronic
967790750 3:193546411-193546433 GGGTGCTGCAGCTGAGAAGATGG - Intronic
968299277 3:197600873-197600895 GGGTGCTGCAGGGGAGCAGTTGG - Intergenic
969352186 4:6604277-6604299 GGTTGCTGCAGTGGATGGGTTGG + Intronic
969405942 4:6991748-6991770 GGGGGCTGGTGTGGAGGAGATGG + Intronic
969458629 4:7315478-7315500 GGCTGGTGCGGTGGAGGAGAGGG + Intronic
970133273 4:12894288-12894310 GTCTGCTGCAGTGGAGGACAAGG + Intergenic
970200563 4:13600365-13600387 TGCTGCAGCAGTGGAAGAAAGGG - Exonic
970479824 4:16461576-16461598 GCCTGCTGCATTGGAACAGAAGG + Intergenic
970666553 4:18343200-18343222 GGCAGCTGCAGTGGAGGAGCTGG + Intergenic
971221088 4:24706528-24706550 GGGAGCTGGAGTGCAAGGGAAGG - Intergenic
971545284 4:27878776-27878798 GGGTGTGGCAGAGTAAGAGAGGG - Intergenic
971923298 4:32971747-32971769 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
972648968 4:40997222-40997244 GGGTGCTGCAGCTGAGGAGATGG - Intronic
974553939 4:63418798-63418820 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
976161966 4:82211184-82211206 GCCTGCAGCAGAGGAAGAGAAGG - Intergenic
976365023 4:84223381-84223403 GGGTGGTGGGGTGGAAGTGATGG - Intergenic
976370214 4:84279256-84279278 GGGCCTTGCAGTGGAAGACATGG - Intergenic
976632760 4:87255933-87255955 GGGTGCTGCAGCTGAGAAGATGG - Intergenic
976633407 4:87263059-87263081 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
976659470 4:87524679-87524701 AGGTGCTGCAGCTGAGGAGATGG - Intronic
977571361 4:98632791-98632813 GAGGACTGGAGTGGAAGAGAAGG + Intronic
978779592 4:112536529-112536551 TGGTGGTGCAGGGGAAGAAATGG - Intergenic
979078890 4:116309782-116309804 GGGTGCTGCATTTGAGGACATGG + Intergenic
979366478 4:119830603-119830625 GGATGCTGCAGTGGAGCAGCTGG + Intergenic
979713945 4:123814213-123814235 GGGAGCTGAAATGGAAGAAATGG - Intergenic
979946862 4:126843391-126843413 GAGTGAAGCAGTGGAATAGAAGG + Intergenic
980311777 4:131140742-131140764 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
980429930 4:132681390-132681412 GGGTGAAACAGTGGAAGAAATGG + Intergenic
980480025 4:133376367-133376389 GTGTGCTGTAGTGAAAGAGAGGG - Intergenic
980570068 4:134603263-134603285 GTGAGTTGCAGTGAAAGAGAAGG - Intergenic
981147260 4:141339689-141339711 GGGTGCTGCAACTGAGGAGATGG - Intergenic
981930815 4:150187508-150187530 GGGTGCTGCAGTACTAAAGAGGG - Intronic
981939447 4:150266454-150266476 AGGTGGTGCAGGGAAAGAGATGG + Intronic
982102050 4:151977606-151977628 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
982448324 4:155521574-155521596 GGGTGCTGCAGCCCAGGAGATGG + Intergenic
982888028 4:160808369-160808391 TTGTGCTGCAGTGGCAGAGTTGG + Intergenic
983066970 4:163222334-163222356 GGATGCTGCAGCTGAGGAGATGG - Intergenic
983118866 4:163854917-163854939 GGGTGGTGGAGTGGAAAAGTAGG - Intronic
984783668 4:183548991-183549013 TGGTGCTGCAGTCAAGGAGATGG - Intergenic
985062659 4:186094135-186094157 GGGTGCAAAAGTGGAGGAGAAGG - Intergenic
985206967 4:187549439-187549461 AGGTGCTGCAGGCCAAGAGATGG + Intergenic
985234283 4:187856105-187856127 GGGTGCTGCAGCTGAGAAGATGG + Intergenic
985245894 4:187979416-187979438 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
985283145 4:188306816-188306838 GGGTGTTGCAGCTGAAAAGATGG + Intergenic
985295254 4:188431055-188431077 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
985411828 4:189693729-189693751 TGGTGCTGCAGCTGAGGAGATGG - Intergenic
985429469 4:189865071-189865093 TGGTGCTGCAGGAGAAGGGATGG - Intergenic
985966712 5:3343351-3343373 GGGTGCTGCTGTAGAGGAGCTGG + Intergenic
986286043 5:6359967-6359989 GGCTGCTGATGAGGAAGAGATGG - Intergenic
986735564 5:10665188-10665210 GGGGGCTTCAGGGGCAGAGACGG + Intergenic
986897836 5:12392450-12392472 GGGTGCTGCACTGGAGAAGGTGG - Intergenic
986954883 5:13138523-13138545 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
987316609 5:16730390-16730412 AGGTGCTGTGGTGGAAGGGAAGG + Intronic
987842978 5:23244727-23244749 GGCTGATGGAGTGGAAGTGATGG - Intergenic
988039597 5:25872670-25872692 GGTTGCTGCAGCTGAGGAGATGG - Intergenic
988045756 5:25950888-25950910 AGGTGCTGCAGTTGAGGACATGG + Intergenic
988315637 5:29623224-29623246 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
988409593 5:30870118-30870140 CTGTGCAGCAGTGGAAGTGATGG + Intergenic
988566244 5:32321762-32321784 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
988911494 5:35847893-35847915 GGGTGCTGCAACTGAGGAGATGG + Intergenic
990352667 5:54934507-54934529 GGTAGCAGCAGTGGAAGTGATGG + Intergenic
991717861 5:69468713-69468735 GGGTGCTGCAGCTGAAGACATGG + Intergenic
993209878 5:84934462-84934484 GGGGGGTGGGGTGGAAGAGAGGG - Intergenic
993404163 5:87490076-87490098 GGGGGCTGCAATGTAAGACAAGG + Intergenic
993689696 5:90984654-90984676 GGATACAGCAGTGAAAGAGATGG - Intronic
994453285 5:99971309-99971331 GGGTGCTGCAGTCAAAGAGATGG + Intergenic
994571503 5:101520594-101520616 GGGTGCTGCAGCTGAAGAGATGG - Intergenic
994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG + Intergenic
995181109 5:109231087-109231109 GGGTGCTGCAGTTGGAGAGGAGG + Intergenic
997294913 5:132763199-132763221 GGGTACTGTAGGGGTAGAGAAGG - Intronic
997505229 5:134411815-134411837 GGCTGCCGCAGTGGAGGAGCTGG - Exonic
998943121 5:147306407-147306429 AGGTGCTGAAATGGAGGAGAAGG + Intronic
999205227 5:149842830-149842852 GGGTGCTGCAGAGGAAGCACAGG - Intronic
999205229 5:149842850-149842872 TGCTGCTGCAGAGGAAGGGAGGG - Intronic
999435799 5:151562430-151562452 TGGTGCTGCAGTGTGAGAGCTGG - Intronic
1000540849 5:162538079-162538101 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1000944238 5:167400710-167400732 AGGTGAGTCAGTGGAAGAGATGG + Intronic
1001000729 5:168004449-168004471 GAGTGGAGCAGTGAAAGAGAAGG + Intronic
1001023504 5:168204210-168204232 GAGAGCTGCAGTGGGAGAGGTGG - Intronic
1001414526 5:171535567-171535589 GGGTACTGCAGTGACTGAGACGG + Intergenic
1001708126 5:173756836-173756858 GGGGGCTGCAGTGGAGGAAGGGG - Intergenic
1001867591 5:175118783-175118805 GGATGCTGCAGTGGGAGCCAGGG - Intergenic
1002526504 5:179818631-179818653 GGGGGCTGAGGTGGAAGAGTGGG - Intronic
1002655336 5:180742059-180742081 AGGTTCTGCACTGGAAGATAAGG - Intergenic
1002842476 6:918123-918145 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1002905181 6:1442594-1442616 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1003043412 6:2710652-2710674 GGGTGCTGCAGCCAAGGAGATGG - Intronic
1003068266 6:2921251-2921273 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1003119821 6:3310218-3310240 GGGTGCTCCAGTGGGAGACAGGG - Intronic
1003119832 6:3310257-3310279 GGGTGCTCCAGTGGGAGACAGGG - Intronic
1003119842 6:3310296-3310318 GGGTGCTTGAGTGGGAGACAGGG - Intronic
1003119857 6:3310355-3310377 GGGTGCTCGAGTGGGAGACAGGG - Intronic
1003119861 6:3310375-3310397 GGGTGCTCGAGTGGGAGACAGGG - Intronic
1003119865 6:3310395-3310417 GGGTGCTTGAGTGGGAGACAGGG - Intronic
1003119869 6:3310415-3310437 GGGTGCTCGAGTGGGAGACAGGG - Intronic
1003149133 6:3533894-3533916 GTGTGATGGAGTGGAAGAGATGG + Intergenic
1003478183 6:6504708-6504730 GGCAGCTTCAGTGGAAGACAGGG - Intergenic
1003902666 6:10669159-10669181 TGGTTCTGGAGGGGAAGAGAGGG + Intergenic
1004144887 6:13056633-13056655 GGGTCTTGCAGTGGGAGAAATGG + Intronic
1004183540 6:13401385-13401407 GGGTCCAGTAGTGGAAGGGAAGG + Intronic
1005035154 6:21549178-21549200 AGGTGCTGCAGAAGAGGAGATGG + Intergenic
1006318278 6:33304016-33304038 GGATGCTGGAGTGGTAGAGGTGG + Intronic
1006975007 6:38091786-38091808 GGGTGCCGAAGTGGAACAGACGG + Intronic
1007369926 6:41420067-41420089 GGGGGTTGCAGTGGATGAGGTGG + Intergenic
1008204943 6:48643455-48643477 GGGTGCTGCAGCCAAGGAGAAGG - Intergenic
1008310198 6:49959184-49959206 AGGTGCTGCAGTGAAGAAGATGG - Intergenic
1010120559 6:72370849-72370871 GAATGCTGCAGAGGAAGAGGAGG + Intronic
1011008626 6:82677946-82677968 AGGTGCTGCAGCTGAAGAGATGG + Intergenic
1012499796 6:99875743-99875765 AGTTGCAGCAGTGGAAGGGATGG + Intergenic
1012509619 6:99988276-99988298 GATAGCTGCAGTGGAAAAGAAGG - Intronic
1012628059 6:101428857-101428879 GTGTGATGCAGTGGAAGAGCAGG - Intronic
1012976244 6:105784035-105784057 GGGTGCTGCTCTGGAAGAAATGG - Intergenic
1013078115 6:106789006-106789028 GTGTGCTGAAGTGGAAGGAAAGG - Intergenic
1013162545 6:107559971-107559993 GGGGGCAGCAGTGGGGGAGAGGG + Intronic
1014139889 6:117929240-117929262 TGGTGCTGCAGCTGAGGAGATGG - Intronic
1014682651 6:124451806-124451828 GAGTGCTTCAAGGGAAGAGATGG + Intronic
1015277295 6:131397421-131397443 GGGGGTTGGAGTGGAAGAAAGGG + Intergenic
1016200629 6:141403180-141403202 TGGTGCTGCAGCTGAGGAGACGG - Intergenic
1016236412 6:141872690-141872712 GGGTGCTGCAGCCGAGGAGTTGG - Intergenic
1017383688 6:153858842-153858864 GGGTGCTGCAGTCGAGGAGATGG - Intergenic
1017457295 6:154613241-154613263 GGATCCTGCAGTGTCAGAGAGGG + Intergenic
1017713504 6:157190833-157190855 GGGTGGCGCGGTGGGAGAGAGGG + Intronic
1017748251 6:157466320-157466342 GGGTGCTACTGTGGAGCAGATGG - Intronic
1018369711 6:163156492-163156514 GGCAGCAGCAGTGGAAGAGGAGG - Intronic
1018416854 6:163609122-163609144 AGGTGCTGAAGTGGAAGTGGGGG - Intergenic
1018498955 6:164381916-164381938 GGGTTCTTCAGTGCAAAAGAGGG + Intergenic
1018614737 6:165676447-165676469 AGGTGCCGCAGAGGAAGAGGTGG + Intronic
1018767265 6:166944456-166944478 GGGGGCTGGAGGGGAAGAGGAGG - Intronic
1019104888 6:169660062-169660084 CCCTGCTGCAGTGGAGGAGAGGG + Intronic
1019919842 7:4156541-4156563 GAGGGCTGCAGTGGAAAAGCAGG + Intronic
1020002192 7:4762340-4762362 GGGCTCTCCAGTGGAAGAGGCGG - Exonic
1020771298 7:12398572-12398594 GGGTGCTCCAGCTGAGGAGATGG - Intronic
1021477826 7:21082435-21082457 GGGTGCTCTACTAGAAGAGATGG + Intergenic
1021588697 7:22237671-22237693 AGGTGCTGCAGCGGAGGAGTTGG - Intronic
1022115260 7:27255305-27255327 GGGTGCTCCATTGGATCAGAAGG - Intergenic
1022469892 7:30675590-30675612 GGGAGCGGAAGTGGAAGAGGAGG - Intronic
1022958187 7:35400525-35400547 GGGTGCTCCAGAGGAGGAAATGG + Intergenic
1023175177 7:37429205-37429227 GGGTGCTGCAGACTAAGGGATGG + Intronic
1023175195 7:37429314-37429336 GGGTGCTGCAGACTAAGGGATGG + Intronic
1023395665 7:39749717-39749739 GGCTGCTACAGAGGAAGAGTGGG - Intergenic
1024307715 7:47942219-47942241 AGGTGCTGCAGATGAGGAGAAGG - Intronic
1024421379 7:49170925-49170947 AGGTGCTGCAGCCAAAGAGATGG - Intergenic
1024654800 7:51442569-51442591 GGGTGCTGCGGCTGAGGAGATGG + Intergenic
1024794656 7:53007101-53007123 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1025734375 7:64134018-64134040 GAGTGCTGCAGTCAAGGAGATGG + Intronic
1025938102 7:66053179-66053201 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1025956335 7:66185985-66186007 GGGTGCTGCAGGCCAGGAGAGGG - Intergenic
1026147895 7:67763710-67763732 GGGTGCTGGGGTACAAGAGATGG + Intergenic
1026160195 7:67861947-67861969 CGGTGCTGCAGTTAAGGAGATGG + Intergenic
1026280432 7:68917430-68917452 GGGTGCTGCAGCTGAGGATATGG - Intergenic
1026288769 7:68987123-68987145 GGGACTTGCAGTGGAAAAGAGGG - Intergenic
1026461025 7:70615210-70615232 GGGTGATGGGGTGGAAGAGTGGG + Intronic
1026822989 7:73562160-73562182 GGGTGCTGCAGTAGAGGAAGCGG - Intergenic
1027749659 7:82126844-82126866 GGGTGTTGCAGCTGAGGAGATGG - Intronic
1027779453 7:82503979-82504001 TGCTGCAGCAGAGGAAGAGAGGG - Intergenic
1029023665 7:97391514-97391536 AGGTGCTGCAGTGAAGGAGATGG - Intergenic
1029159859 7:98543870-98543892 GGGTCCCACAGTGGTAGAGATGG + Intergenic
1029162610 7:98563373-98563395 GGGTGCTGTGGGGGCAGAGATGG + Intergenic
1029285976 7:99466320-99466342 GGGTCCTGCAGTTAGAGAGAGGG + Exonic
1030282330 7:107789867-107789889 GGATGATGCGGTGGAAGGGAAGG - Intronic
1030901020 7:115123609-115123631 TGGTGCTGCAGTGGAAGCTTCGG + Intergenic
1032557293 7:132849870-132849892 GGGTGCTGCAATGGAATAATAGG + Intronic
1033242979 7:139696057-139696079 GTGTGCTGCAGATGAACAGAAGG + Intronic
1033262803 7:139858181-139858203 GGCTGCTGCCTTGGAACAGATGG - Intronic
1033342686 7:140504444-140504466 GGGTGCTGCAGCCCAGGAGATGG - Intergenic
1033928969 7:146500318-146500340 AGGTGCTACAGTCGAGGAGATGG + Intronic
1034167459 7:149036839-149036861 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1034983110 7:155490936-155490958 GGGTGCTGCAGGGGGGCAGAGGG - Intronic
1035017886 7:155782333-155782355 GGGTGCTGCAGGTGGAGAGTGGG - Intergenic
1035457307 7:159016946-159016968 GTCTGCAGCAGTGGAAGGGAAGG - Intergenic
1035457318 7:159017012-159017034 GTCTGCAGCAGTGGAAGGGAAGG - Intergenic
1035728798 8:1840858-1840880 GGGTGCTGCTGGGGTGGAGAGGG + Intronic
1036518915 8:9472323-9472345 AGGTGCTCCAGTGGAGGAGATGG - Intergenic
1036547367 8:9784859-9784881 GGGTGCTGTAGTCAAGGAGATGG + Intergenic
1037422336 8:18716356-18716378 GGGCTCTGCAGTGGAATAAATGG + Intronic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1038211174 8:25520445-25520467 GGGTGCTACAGAGAAGGAGATGG + Intergenic
1038214131 8:25546140-25546162 GGGTGCTACAGAGGAGGAGATGG + Intergenic
1038459870 8:27706735-27706757 GGATGTTGCAGTGGAAGAAGAGG + Intergenic
1038605777 8:29002293-29002315 GGGTGGGGCAGTGGGAGAGAGGG + Intronic
1039086021 8:33780886-33780908 TGTTTCTGCAGTGTAAGAGAGGG + Intergenic
1039431605 8:37529347-37529369 GGGTGCTGCAGGGGAAAGGAAGG - Intergenic
1039781731 8:40792741-40792763 GGGGACTGGAGGGGAAGAGAGGG + Intronic
1040013109 8:42678683-42678705 GGGAACTGGAGTGGAAGTGAGGG - Intergenic
1040659215 8:49549661-49549683 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1040659426 8:49552938-49552960 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1041834625 8:62197784-62197806 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1042397283 8:68307038-68307060 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1042852702 8:73232341-73232363 GGGTGCTACAGCCAAAGAGATGG - Intergenic
1043187621 8:77174389-77174411 GGGCACAGCAGTGGAATAGAGGG - Intergenic
1044553683 8:93539128-93539150 GAGTGCTGCTGTGGTGGAGAGGG + Intergenic
1045492041 8:102677346-102677368 AGGTGCTGGAGTGGAAGCGAAGG - Intergenic
1045493881 8:102691834-102691856 GGGTGCTACAGGTGAGGAGATGG - Intergenic
1046681650 8:117177258-117177280 GGGTGCTGCAGAAGAAGAAAGGG + Intergenic
1047307850 8:123667651-123667673 GGGTGCTGCAGCTGAGGAGGTGG + Intergenic
1047503545 8:125461005-125461027 CTGTGCTACGGTGGAAGAGATGG - Intergenic
1048010667 8:130452898-130452920 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1048029263 8:130615684-130615706 GGGGAGGGCAGTGGAAGAGATGG - Intergenic
1048592425 8:135833244-135833266 GGGTGCTGATGTGGAAGACAAGG - Intergenic
1049008000 8:139868468-139868490 GCGTGCTGCAGTGGAATACGTGG + Intronic
1049282927 8:141759698-141759720 GGAAGCTGCAGAGGAAAAGAGGG - Intergenic
1049574625 8:143384521-143384543 GGGGGCAGCAGGGGAGGAGATGG - Intergenic
1049737067 8:144214267-144214289 GGGTGCTGCACTGGAAGAAGGGG - Intronic
1049864430 8:144924818-144924840 GGGCGCTGTAGTGGAGGTGACGG + Intergenic
1050363787 9:4855419-4855441 GTGTAGTGCTGTGGAAGAGAGGG + Intronic
1051118701 9:13728199-13728221 GGGGGATGAAGAGGAAGAGAAGG - Intergenic
1051136122 9:13923578-13923600 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1052034914 9:23669657-23669679 TTGTGCTACAGTGGAAGAGCTGG + Intergenic
1052424784 9:28290546-28290568 GGGTGCTACAGCTGAGGAGATGG + Intronic
1052789989 9:32866351-32866373 GGGAGCAGTAATGGAAGAGATGG - Intergenic
1054738637 9:68781566-68781588 GGGTACTGAAGTGGATGGGAGGG + Exonic
1055059049 9:72049959-72049981 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1055189817 9:73504340-73504362 GGGTGCTGCTGCTGAGGAGATGG - Intergenic
1055720093 9:79163723-79163745 TGGTGCTGTGGTGTAAGAGAGGG - Intergenic
1056573910 9:87840177-87840199 GGGTGCTGCAGCTGAGAAGATGG + Intergenic
1056715892 9:89027842-89027864 GAGTCTTGCAGTGGAGGAGAGGG + Intronic
1057149457 9:92783498-92783520 GGGTGCTGCAGCCGAGTAGATGG + Intergenic
1057200711 9:93138332-93138354 GGGAGCCCCAGTGGGAGAGACGG - Intergenic
1057395794 9:94678920-94678942 AGGTGCTGCAGCTAAAGAGATGG + Intergenic
1057410258 9:94811517-94811539 GGGGGCAGCTGTGGTAGAGAAGG - Intronic
1057871374 9:98720798-98720820 GGGTGCTGCAGTGAGAGGGATGG - Intergenic
1058318645 9:103601443-103601465 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1058649964 9:107166567-107166589 GGGACCTGCAGTGGGAGATAAGG - Intergenic
1058955805 9:109947056-109947078 TGGTGATGGGGTGGAAGAGAAGG + Intronic
1059049569 9:110909188-110909210 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1059143553 9:111876752-111876774 GGGTGCTGCAGTGATAAACAGGG - Intergenic
1060740625 9:126095572-126095594 GGCAGCTGCAGTGGCAGAGGTGG + Intergenic
1060875012 9:127077018-127077040 AGCAGCTGCAGTGGAAGGGAGGG + Intronic
1061382310 9:130265835-130265857 GGGTGCTGCGGTGGAGGCGCAGG - Intergenic
1061386990 9:130296208-130296230 GGCTGCTGCCCTGGAAGAGTGGG + Intronic
1061516270 9:131092331-131092353 GGGAGCTGCTGTGAAACAGAGGG - Exonic
1061917407 9:133762645-133762667 GGGAGCGGCAGGGGGAGAGAGGG - Exonic
1062038962 9:134395515-134395537 GCGGGCTGCAGTGAAGGAGATGG + Intronic
1062211796 9:135368664-135368686 GGGTGTTGCAGCCGAGGAGAGGG - Intergenic
1062303387 9:135888377-135888399 GTGTGCTGCCGTGGAAGAGCTGG - Intronic
1203662621 Un_KI270753v1:59577-59599 CGGTGCTGCAGCTGAGGAGATGG - Intergenic
1203670769 Un_KI270755v1:9252-9274 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1186056556 X:5655278-5655300 AGGTGCTGCAGTCGAGGAAATGG + Intergenic
1186095006 X:6091068-6091090 GGGAGCAACAGTGGTAGAGAGGG + Intronic
1186390296 X:9151955-9151977 GGGTGCTACAGCCAAAGAGATGG + Intronic
1186661811 X:11675473-11675495 GGGTGCTGCAGTCAAGGAGCTGG - Intergenic
1188618908 X:32195050-32195072 GGGAGATGCAGAGGAAGAGAAGG + Intronic
1188858790 X:35231096-35231118 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1189992947 X:46611853-46611875 GGGCGCTGGGGCGGAAGAGAAGG - Intronic
1190281588 X:48934608-48934630 GGGTTCTGCAGAGAAAGAGAAGG + Exonic
1191951007 X:66593259-66593281 GAGTAGTGCAGTGAAAGAGAAGG - Intergenic
1192174008 X:68874619-68874641 GGGGGCTGAAGAGGAAAAGAGGG + Intergenic
1192351837 X:70362314-70362336 GGGTGCTGCGGATGTAGAGAGGG + Intronic
1192363676 X:70454526-70454548 GTGGGCTGCAGTGCAGGAGAAGG + Intronic
1193298776 X:79864351-79864373 GGGGGCTGCAGTGCAACAGCTGG + Intergenic
1194085091 X:89516479-89516501 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1194282099 X:91965948-91965970 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1195878605 X:109569166-109569188 GCATTATGCAGTGGAAGAGAAGG + Intergenic
1196732647 X:118956709-118956731 GGGTGCTGCAGTTGAGGAGTTGG + Intergenic
1197082005 X:122429647-122429669 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1197228859 X:123981749-123981771 GGATGCAGCAGTGAAAAAGAGGG + Intronic
1197757085 X:130002925-130002947 GGGGTGGGCAGTGGAAGAGAAGG + Intronic
1197992073 X:132329118-132329140 GAGTGCTGCATTGGAATACATGG + Intergenic
1198079754 X:133228101-133228123 TGGAGTTGGAGTGGAAGAGAAGG + Intergenic
1198256011 X:134924996-134925018 GGGTGCTGCAGTCAAGAAGATGG + Intergenic
1198369764 X:135979078-135979100 GGGTGCTGCAGCCGAGAAGATGG - Intergenic
1199102632 X:143821854-143821876 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1199788709 X:151129735-151129757 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1200056696 X:153465340-153465362 GGCTGCAGCAGAGGCAGAGAGGG + Intronic
1200267764 X:154654962-154654984 GGGTGCTGCAGCCGGGGAGATGG - Intergenic
1200437739 Y:3172363-3172385 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1200599693 Y:5190609-5190631 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1202390984 Y:24370319-24370341 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1202479800 Y:25299797-25299819 GGGTGCTGCAGCCAAGGAGATGG + Intergenic