ID: 1037974275

View in Genome Browser
Species Human (GRCh38)
Location 8:23199108-23199130
Sequence TGCCTGTCCCCTTGTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037974275 Original CRISPR TGCCTGTCCCCTTGTGAGGG TGG Intronic
900417848 1:2543260-2543282 TGCTGGTCCCGTGGTGAGGGAGG + Intergenic
902544000 1:17174908-17174930 TTCCTGTCGCCTTGTGAAGAAGG + Intergenic
903135648 1:21307824-21307846 GCCCTGCCCCCTTGAGAGGGAGG + Intronic
903236250 1:21952613-21952635 TCCCTCTCCCCTTGTGGGGTGGG - Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903867768 1:26411278-26411300 TGGCTGTCCACTTGTGGGGCTGG + Intronic
904376077 1:30083328-30083350 GGCCTGTCTCCTTCTGAGGCTGG - Intergenic
905016851 1:34783701-34783723 TGCCTGTCCACGTGTGTGTGTGG - Intronic
906121329 1:43393684-43393706 TGCCTGTCCCTTTGTGATTAAGG - Intronic
909964875 1:81896336-81896358 TTCCTGTTTCCCTGTGAGGGTGG + Intronic
912518791 1:110231616-110231638 TCCCTGTCCCCTAATGAGTGGGG + Intronic
917928241 1:179806608-179806630 GCCCTGTCCCCTTGGGAAGGTGG + Intronic
920646572 1:207808077-207808099 TGCCCTTCTCCTTGTCAGGGAGG + Intergenic
921669777 1:217912763-217912785 CTCCTGTCACCTTGTGAGGAAGG + Intergenic
922693632 1:227714030-227714052 TGGCTGTCCCTTGGTGAAGGAGG - Intergenic
923288356 1:232519322-232519344 TCTCTGTCCTCTTGTGAGCGTGG + Intronic
1063583553 10:7330908-7330930 TGCCTGTCCCCCTTCCAGGGAGG - Intronic
1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG + Intronic
1064220485 10:13436533-13436555 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
1064246594 10:13672731-13672753 TGCTTGACCCCTGGGGAGGGGGG - Intronic
1065003747 10:21361168-21361190 CTCCTGTCGCCTTGTGAGGAAGG - Intergenic
1066261725 10:33735869-33735891 TGACTATCCCTTTGTGAGGGAGG - Intergenic
1066287443 10:33982127-33982149 CCCCTGTCACCCTGTGAGGGGGG - Intergenic
1066444175 10:35466563-35466585 TGCCTGTTCCCTTCTGTGTGAGG - Intronic
1066662224 10:37747930-37747952 TTCTTTTCCCCTTGTGAGAGGGG + Intergenic
1067426653 10:46216033-46216055 TTCCTGTCACTTTGTGAGGCAGG - Intergenic
1069566212 10:69465059-69465081 TCCCTGTCCCCTTGAGAAGCTGG + Intronic
1070918726 10:80170953-80170975 TGCCTTTCCCCGTGTGGTGGGGG - Intronic
1071592744 10:86891151-86891173 TGCTTGTCCCCTGGTGGTGGTGG + Intronic
1072438426 10:95434082-95434104 TGCCTCTCCCCTCCAGAGGGTGG - Intronic
1074220703 10:111435007-111435029 AGGCTGTCTCCTTCTGAGGGTGG - Intergenic
1075168008 10:120086622-120086644 TGCCTTTCTCCTTGAGTGGGAGG - Intergenic
1075722899 10:124597747-124597769 TGCCTGTGCCCCTGGGTGGGGGG + Intronic
1075974444 10:126683562-126683584 TTACTGTCCCCATGGGAGGGAGG - Intergenic
1076029515 10:127145623-127145645 TGCCTGTCTCCTTTTGAAGATGG + Intronic
1076118271 10:127916375-127916397 TTCCTGTCGCCTTGTGAAGAAGG + Intronic
1076741597 10:132488405-132488427 TGCCTGTTCCCAAGTGAAGGTGG + Intergenic
1078431513 11:11292032-11292054 TGCTTCTCCCCTGGTGAGGATGG - Intronic
1080049809 11:27847928-27847950 TGCCTGTTTCCTTTTCAGGGGGG - Intergenic
1080228027 11:29983084-29983106 TGCTTGTTGCCTTGTGAAGGAGG - Intergenic
1080623017 11:34003249-34003271 TTCCTGCCACCTTGTGAAGGAGG + Intergenic
1080814933 11:35746284-35746306 TGGCTGTCCACAGGTGAGGGAGG - Intronic
1080824530 11:35836856-35836878 TGCCTGTCCACTGGTCATGGAGG + Intergenic
1081628889 11:44673942-44673964 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1081853528 11:46290173-46290195 AGCCTGTCCCTTTGCAAGGGCGG - Intronic
1083966441 11:66046711-66046733 TGCCTGTCCCCAAGCTAGGGTGG + Intronic
1084945860 11:72638037-72638059 TTCCTGTCTCCTTGCCAGGGGGG + Intronic
1086401070 11:86461301-86461323 TGTTTGTCCCCCAGTGAGGGAGG + Intronic
1087427621 11:98011505-98011527 TTCCTGCCCCCTTGTGAAGAAGG - Intergenic
1089741811 11:120589746-120589768 TGCCTGTCTCCTGTTGAGGCCGG - Intronic
1092712610 12:11353843-11353865 GACTTGTCCCCTTGTGGGGGTGG + Exonic
1098536546 12:71599721-71599743 TTCCTGTCGCCTTGTGAAGAAGG + Intergenic
1099373897 12:81872407-81872429 TTCCTGCCACCTTGTGAAGGAGG - Intergenic
1099383189 12:81980738-81980760 TTCCTGTCACCTTGTGAAGAGGG + Intergenic
1100039564 12:90298339-90298361 TGCCTGACAGCTTGTGAGGAAGG - Intergenic
1102466851 12:113135208-113135230 TGGCTGTCCCGGTGGGAGGGGGG - Intronic
1102882150 12:116493836-116493858 GACCTGTCCCCCAGTGAGGGAGG - Intergenic
1103850985 12:123933571-123933593 TGCCTGTCCCTTTGAGTTGGAGG - Intronic
1106046646 13:26148115-26148137 TTCCTGCCCCCTTGTGAAGAAGG - Intronic
1106244291 13:27933973-27933995 TAGCTGTCCCCATCTGAGGGAGG - Intergenic
1106397287 13:29393465-29393487 TGGCTGTTCTCTTGTCAGGGAGG + Intronic
1107941698 13:45382183-45382205 TGCCTCCCCCCCTGTGATGGGGG + Intergenic
1108053000 13:46464089-46464111 TGCCTCTCCCCCTGCGATGGGGG - Intergenic
1109425048 13:62156928-62156950 TGCCTGTCCATTTGCTAGGGAGG - Intergenic
1109537930 13:63740998-63741020 TGCCTCCCCCCTTGCGATGGGGG + Intergenic
1110095616 13:71516076-71516098 TGCCTATCTCCTTGTGATGAGGG - Intronic
1111189690 13:84791191-84791213 TTCCTGTCACCTTGTGAAGGAGG + Intergenic
1111920264 13:94402751-94402773 TTCCTGTCACCTTGTGAAGAAGG - Intronic
1112265453 13:97919534-97919556 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
1112541168 13:100314450-100314472 TCCCTCTCCCCTTTGGAGGGTGG + Intronic
1113211870 13:107993015-107993037 TCCCTGCCACCTTGTGAGGAAGG - Intergenic
1113608781 13:111628767-111628789 TGCCTCTCCCCAAGTCAGGGTGG - Intronic
1113724821 13:112590510-112590532 TGCCTGTATCTTTGTGATGGTGG - Intergenic
1113855757 13:113444643-113444665 TGCCTGACCCCGCGGGAGGGAGG - Intronic
1113956598 13:114102780-114102802 TTCCTGACCCCTGGGGAGGGCGG + Intronic
1113957292 13:114105571-114105593 TGCCTGTGGCCTTGTCAGGCAGG - Intronic
1115961510 14:38838793-38838815 TGCCTGTTTCCTGGTGAGGCTGG + Intergenic
1116685649 14:48035625-48035647 TGCCTGTTCCTTTGTGGAGGGGG + Intergenic
1117441926 14:55767998-55768020 TCCTTGTTCCCTTGTGAGGAAGG + Intergenic
1117568748 14:57024206-57024228 CGCCTGCCACCTTGTGAAGGAGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118484376 14:66200006-66200028 GTCCTGCTCCCTTGTGAGGGAGG + Intergenic
1118760610 14:68878511-68878533 TGCCTGTCTTCTTCTGTGGGGGG + Exonic
1119643563 14:76331649-76331671 TGCCTGTCCTCTTGTCCAGGGGG + Intronic
1122156735 14:99754469-99754491 TGCCTGGCTCCCTGTGTGGGAGG + Intronic
1122319065 14:100842486-100842508 TTCCTGTACCTTTGTGAGGCCGG - Intergenic
1122773625 14:104107803-104107825 TGCCTGTGCCCCTGCGTGGGGGG + Intronic
1123906791 15:24929553-24929575 TGGGTGTCCCCTCATGAGGGTGG + Intronic
1124485734 15:30114183-30114205 GCCCTGTCCTCTTGTGAGTGGGG + Intergenic
1124517841 15:30383085-30383107 GCCCTGTCCTCTTGTGAGTGGGG - Intronic
1124540812 15:30583169-30583191 GCCCTGTCCTCTTGTGAGTGGGG + Intergenic
1124757844 15:32424411-32424433 GCCCTGTCCTCTTGTGAGTGGGG - Intergenic
1125303501 15:38283178-38283200 CTCCTGTCGCCTTGTGAGGAAGG - Intronic
1126257535 15:46645398-46645420 TGTCAGTCCCCTTATGTGGGTGG + Intergenic
1128319480 15:66682898-66682920 TGACTGTAGCCTTGTGAGAGAGG + Intronic
1129463531 15:75711657-75711679 GGCCTGGGCCCTTGTGAAGGAGG + Intronic
1129721355 15:77879745-77879767 AGCCTGGGCCCTTGTGAAGGAGG - Intergenic
1130329813 15:82913224-82913246 TCCCTGTGCCCTGGAGAGGGTGG + Intronic
1130909439 15:88261051-88261073 TGACTGTCCCCTTTTGTGGGTGG - Intergenic
1131677853 15:94689511-94689533 CTCCTGTCCCCTTGTGAAGAAGG + Intergenic
1131779984 15:95845830-95845852 AGCCTGTCCCCTTTTGTGGAAGG + Intergenic
1132533691 16:466852-466874 CGCCTGTCTGCTTGAGAGGGCGG + Intronic
1133227244 16:4347479-4347501 TTACTGTCCTCTTGTGAGGAGGG - Intronic
1133419787 16:5636476-5636498 TGCCTGGCCCCATGAGCGGGAGG - Intergenic
1134688604 16:16175871-16175893 AGCCTGTGCCCTTCTGAGTGTGG + Intronic
1136448945 16:30341645-30341667 TGCCTGTCCCAAAGTGAGGCAGG - Intergenic
1136690488 16:32024968-32024990 TGAATGTCCCTTTGTGGGGGAGG - Intergenic
1136791075 16:32968528-32968550 TGAATGTCCCTTTGTGGGGGAGG - Intergenic
1137256264 16:46777983-46778005 TACCTGTGCTCTTGTGGGGGCGG + Intronic
1138499102 16:57427623-57427645 TCCCTGCCACCTTGTGAAGGAGG + Intergenic
1140270345 16:73459761-73459783 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1140890219 16:79278760-79278782 CTCCTGTCCCCCTGTCAGGGCGG - Intergenic
1141963704 16:87426670-87426692 TGCCTGTCCCCTTAGGGGTGTGG - Intronic
1142046487 16:87928410-87928432 TGCCTGTCCCAAAGTGAGGCAGG + Intronic
1142144034 16:88485253-88485275 GGCCTGTCCCCTGGTGCTGGGGG + Intronic
1203093283 16_KI270728v1_random:1229989-1230011 TGAATGTCCCTTTGTGGGGGAGG - Intergenic
1143252342 17:5532912-5532934 TGCAGGTCCCCTTGAGAGGCAGG + Exonic
1143831741 17:9657641-9657663 TTCCTGCCACCTTGTGAAGGAGG - Intronic
1145243413 17:21252696-21252718 GACCTGTCCCCTTCTGCGGGTGG - Intronic
1145866272 17:28243867-28243889 TTCCTGCCACCTTGTGAGGAGGG + Intergenic
1145892357 17:28426157-28426179 AGCCTGTCCCCAGGTGAGGTCGG - Intergenic
1146465051 17:33079797-33079819 TTCCGGTCCCCCTGTGAGGTAGG + Intronic
1147153347 17:38531104-38531126 TGAATGTCCCTTTGTGGGGGAGG - Exonic
1148456787 17:47815425-47815447 TGACAGTTCCCTTGAGAGGGAGG + Intronic
1148541412 17:48483559-48483581 TGCCTGTTTCCATGTGAGGGAGG - Intergenic
1148689057 17:49516255-49516277 TCCCTGACCCCTGGTGTGGGTGG - Intergenic
1148795809 17:50196145-50196167 TGCCGGGCCCCCTGTGAGTGTGG - Exonic
1150233220 17:63570545-63570567 CTCCTCTTCCCTTGTGAGGGAGG + Intronic
1152167842 17:78722485-78722507 AGCCTGCCCCCTTGGGAGGAGGG - Intronic
1152263643 17:79280827-79280849 AGGCTGTCCCATTGTGGGGGGGG + Intronic
1152746614 17:82043302-82043324 GGTCTGTCCCCTCCTGAGGGTGG - Intergenic
1154393493 18:13965395-13965417 TTCCTGTCACCTTGTGAAGAAGG - Intergenic
1155919462 18:31588707-31588729 TTCCTGACGCCTTGTGAGGAAGG - Intergenic
1157691195 18:49683190-49683212 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1158877997 18:61751568-61751590 TGCCTGTCCCTCTGTGTGGCTGG - Intergenic
1158939611 18:62394996-62395018 TGCCTGCACACTGGTGAGGGTGG - Intergenic
1159070018 18:63612949-63612971 TTCCTGTCACCTTGTGAAGAAGG - Intergenic
1159672363 18:71237218-71237240 TTCCTGTCGCCTTGGGAGGAAGG + Intergenic
1160547844 18:79672807-79672829 TGCCAGTCCTCTTGTAAGGAGGG + Intergenic
1161282770 19:3454653-3454675 TGTCTGGCGCCCTGTGAGGGTGG - Intronic
1161701324 19:5797482-5797504 TGACTGTCCCCTGCTCAGGGTGG + Intergenic
1161865884 19:6831999-6832021 TGCCTGTTCCCTACAGAGGGAGG + Intronic
1164235105 19:23324931-23324953 TGCATGTCCTCTTGAGAGAGTGG + Intronic
1164291487 19:23872902-23872924 TACATGTCCTCTTGAGAGGGTGG - Intergenic
1164323530 19:24171959-24171981 TGCATGTCCTCTTGAGAAGGTGG - Intergenic
1165146580 19:33734802-33734824 TCCCTGTCCCCATGTCAGGAAGG - Intronic
1166633292 19:44427019-44427041 CTCCTGTCCCCTTGTGAAGAAGG - Exonic
1166751123 19:45164435-45164457 TGCCTGTGCCCTGGGGAGTGTGG + Intronic
925631946 2:5903477-5903499 TCCCTTTCCCTCTGTGAGGGTGG - Intergenic
925767123 2:7246954-7246976 TGCCTGCCCCCATGAGAAGGGGG + Intergenic
926868833 2:17390552-17390574 TTCCTGTTGCCTTGTGAAGGTGG + Intergenic
928757519 2:34545179-34545201 TGGCTGTCCCTTGGTGAAGGGGG + Intergenic
928807669 2:35180459-35180481 TTCCTGTCGCCTTGTGAAGAAGG - Intergenic
930581438 2:53216971-53216993 TGGCTGTCCCTTGGTGAAGGGGG + Intergenic
931286257 2:60834554-60834576 TCCCTGGCCCCCTGGGAGGGAGG + Intergenic
931748640 2:65312165-65312187 TGCCTGTCGCCTTGCCACGGAGG - Exonic
933060977 2:77735849-77735871 TGCCTGCCACCTTGTGAAGAAGG - Intergenic
934897897 2:98134354-98134376 TGGCCTGCCCCTTGTGAGGGCGG + Intronic
935524991 2:104154774-104154796 TGCCTGTCATATTGTGAGGGTGG - Intergenic
938670770 2:133584373-133584395 TGCCTGGCCCTTTGTCAGTGGGG - Intergenic
939703396 2:145421542-145421564 TTCCTGTCACCTTGTGAAGATGG - Intergenic
943878654 2:193109009-193109031 TTCCTGCCACCTTGTGAAGGAGG + Intergenic
943882526 2:193164277-193164299 TTCCTGTCGCCTTGTGAAGAAGG + Intergenic
945065680 2:205945995-205946017 TGCCAGTCCCCTTGAGGGTGTGG + Intergenic
946849880 2:223895480-223895502 TGCGTGACCACTTGTGGGGGTGG - Intronic
947653604 2:231808036-231808058 GGCCCCTCCCCTTGTGAGGAGGG + Exonic
1171486934 20:25491897-25491919 TGCCTCCCTCCTTGGGAGGGAGG - Intronic
1172050830 20:32116462-32116484 TGCCTGTTGCTTCGTGAGGGTGG + Intronic
1173304090 20:41831487-41831509 TCCCTGCCCCATTGTGAGGCAGG - Intergenic
1174753639 20:53137045-53137067 TGCCTGTCCCTGTGTGGGGATGG + Intronic
1174959954 20:55144646-55144668 TTCCTGCCGCCTTGTGAAGGGGG + Intergenic
1175917038 20:62430738-62430760 TGCCTGGGCACTTGGGAGGGCGG + Intergenic
1177481453 21:21695148-21695170 TGCCTGTCCGGTAATGAGGGAGG - Intergenic
1178939096 21:36890087-36890109 TGCCTGCCGCCTTGTGAAGAAGG + Intronic
1179583042 21:42356757-42356779 TGCCTGATCCCTTGACAGGGAGG - Intergenic
1179873892 21:44257816-44257838 TGCCTGGCGCCTTCTGAGGGAGG - Intronic
1179886126 21:44314937-44314959 TCCCTGTCCCCGTGTGAAGGTGG + Intronic
1180186963 21:46144901-46144923 TTCCTGTCCCGTTTGGAGGGAGG + Intronic
1180196163 21:46195644-46195666 TGCCTGTCCTCTGGTGGGTGGGG - Intronic
1183004383 22:34889007-34889029 TTCCTGTCACCTTGTGAGGAAGG + Intergenic
1183341856 22:37285923-37285945 CCCCTGTCCCCTTCTGACGGGGG - Intronic
1183384726 22:37508489-37508511 TGCCCTGCCCCTTGTGCGGGAGG - Intronic
1183672682 22:39282477-39282499 TGCGTGTCCCTTTGTGCGGAGGG + Intergenic
1183688621 22:39375910-39375932 TGCCTGTCCCTTTGGGGGTGGGG + Intronic
1184271651 22:43387884-43387906 TCCCTGGACCCTTGTGAGGGAGG + Intergenic
950420700 3:12897358-12897380 TGCCAGGCTTCTTGTGAGGGAGG + Exonic
950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG + Intronic
951805038 3:26634590-26634612 TGGCTGTTCCCTTGAGATGGGGG + Intronic
952622023 3:35356451-35356473 TTCCTGTCACCTTGTGAAGAAGG - Intergenic
953436643 3:42882494-42882516 TCCCTAGCCCCTTGGGAGGGTGG + Intronic
954625318 3:52019283-52019305 TGCCTGTCCCCTGCTCAGGTGGG - Intergenic
958755864 3:98248522-98248544 TGCCTGTCCACTTGACAGGTAGG - Intergenic
959811441 3:110624971-110624993 AGACTGTCCCATTGTGAGGAAGG + Intergenic
961819331 3:129567208-129567230 TGCCTCTCCCCTTTTCAAGGTGG - Intronic
962612203 3:137087436-137087458 TCCCTGTCACCTTGTGAAGAAGG + Intergenic
964903208 3:161686145-161686167 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
965960516 3:174423594-174423616 TTCCTGTCACCTTGTGAAGAAGG - Intergenic
965965450 3:174483324-174483346 TTCCTGTCACCTTGTGAAGAAGG - Intronic
967210318 3:187162490-187162512 TGCCTTTGCACATGTGAGGGAGG - Intronic
967952698 3:194853196-194853218 TGCCTGTCCCCTGGAGCAGGTGG + Intergenic
970780727 4:19734485-19734507 TTCCTGTCACCTTGTGAAGAAGG - Intergenic
970807182 4:20050500-20050522 TTCCTGTTCCCTTGTGAAGAAGG + Intergenic
971561658 4:28085387-28085409 TTCCTGTCCCCATGTGAGGAAGG - Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
976871852 4:89803784-89803806 TTCCTGTCACCTTGTGAAGTAGG + Intronic
977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG + Intergenic
981107812 4:140901343-140901365 TCCCTCTCCTCTTGTGATGGGGG + Intronic
982732370 4:158970043-158970065 TACCAGTTCCCTTGTGAGGGCGG + Intronic
985726667 5:1519866-1519888 TGCCTGTCCCTTGGGGAGGATGG - Intronic
985972261 5:3387872-3387894 TGTCTCTACCCTTGTGTGGGCGG + Intergenic
986416105 5:7529772-7529794 AGGTTGTGCCCTTGTGAGGGTGG + Intronic
986995670 5:13604461-13604483 CTCCTGTCACCTTGTGAGGAAGG + Intergenic
987463030 5:18237001-18237023 TTCCTGTCACCTTGTGAAGAAGG - Intergenic
990032888 5:51283211-51283233 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
990943036 5:61222745-61222767 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
994000938 5:94778462-94778484 TGGTTGTCCCCTAGGGAGGGGGG - Intronic
995244311 5:109919376-109919398 TTCCTGTCACCTTGTGAAGAAGG + Intergenic
996010271 5:118474611-118474633 TTCCGGTCACCTTGTGAGGAAGG - Intergenic
996365927 5:122701456-122701478 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
996884572 5:128340285-128340307 TGCATGTTCTCTTGAGAGGGGGG + Intronic
997199321 5:132000138-132000160 TGGCTGTGACCTTGTGGGGGTGG - Intronic
997825756 5:137105726-137105748 TGCCTGAGCACGTGTGAGGGAGG - Intronic
998686414 5:144532033-144532055 TGCCTGCCACCTTGTGAAGAAGG + Intergenic
1000210670 5:159104179-159104201 CTCCATTCCCCTTGTGAGGGCGG + Intergenic
1003436315 6:6091720-6091742 TGACTGTCCCAGTGTGAGTGAGG + Intergenic
1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG + Intergenic
1006558834 6:34891279-34891301 TGCCTGCACCCTTGAGAGGTTGG + Intronic
1007991554 6:46261189-46261211 TTCCTGTCCTCTTGTGAGACTGG - Intronic
1008232185 6:48996445-48996467 TGCCTGTGACCTAGTGTGGGAGG - Intergenic
1008545739 6:52581681-52581703 TTCCAGTCACCCTGTGAGGGAGG + Intergenic
1009751323 6:67882290-67882312 TGCCTGTCCAATTGGCAGGGAGG + Intergenic
1012541433 6:100366431-100366453 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1012563994 6:100622397-100622419 TACCTGCCACCTTGTGAGGTAGG + Intronic
1012581747 6:100878722-100878744 CGCCTGCCCTCTTGTGAGAGTGG + Intronic
1016242814 6:141952112-141952134 TTCCTGTCACCTTGTGAAGAAGG + Intergenic
1017922083 6:158881659-158881681 TGCCTGTCCAGTTGGGAGGTAGG + Intronic
1018057221 6:160062594-160062616 AGCCTGTCCCGTTGTCAGAGTGG + Exonic
1021784431 7:24137897-24137919 TGCCTGACCCCTTCTCATGGGGG + Intergenic
1024606033 7:51023479-51023501 AGCTTGTCCCAGTGTGAGGGTGG - Intronic
1029794645 7:102881317-102881339 TGCCTGTCTACTTGGGAGGCTGG + Intronic
1031968287 7:128044316-128044338 TGCCTGTCCCTTTGTGGATGCGG - Intronic
1032894617 7:136236702-136236724 TTCCTGTCGCCTTGTGAAGAAGG - Intergenic
1033014750 7:137661051-137661073 TGGCTGTCCCCTTCTGAATGAGG + Intronic
1033907660 7:146225426-146225448 TGACTGTCCTCCTGTAAGGGTGG - Intronic
1034303289 7:150033998-150034020 TGCCTGCCCCCCTGCGATGGTGG + Intergenic
1034304119 7:150037151-150037173 TGCCTCCCCCCCTGTGATGGGGG + Intergenic
1034310906 7:150086745-150086767 TCCCGGTCACATTGTGAGGGAGG - Intergenic
1034545499 7:151786182-151786204 TGCCTCTGCCCATGTTAGGGGGG + Intronic
1034795940 7:154013889-154013911 TCCCGGTCACATTGTGAGGGAGG + Intronic
1036643326 8:10597504-10597526 TGCCTGTGGCCTTGTGAAGATGG - Intergenic
1037974275 8:23199108-23199130 TGCCTGTCCCCTTGTGAGGGTGG + Intronic
1038073750 8:24046698-24046720 TGACTGTCCCTTGGTGAAGGGGG - Intergenic
1040356632 8:46624781-46624803 TGCCTGTCACCTAGTGATGGTGG + Intergenic
1040637598 8:49293185-49293207 CGCCTGTCACCTTGTGAAGAAGG + Intergenic
1041021337 8:53642235-53642257 TGGCTGTCCCCTGGTGGAGGGGG + Intergenic
1044475668 8:92622766-92622788 TGGTTTTCCCCTTGTAAGGGAGG + Intergenic
1045672480 8:104571547-104571569 TTCCTGTCACCTTGTGAAGAAGG + Intronic
1046804397 8:118463809-118463831 TGCCTGCCCCCTTGTGCTGAAGG - Intronic
1048349056 8:133600926-133600948 AGCCTGTGGCCTTGTCAGGGAGG - Intergenic
1049192384 8:141295495-141295517 TACCTGTCCCCTGCTGAGTGCGG - Intronic
1049455064 8:142682504-142682526 TGCCTGTCCCCTGCTGGGTGCGG - Exonic
1049551586 8:143262262-143262284 TGCCTGTTTCCTGGTGAGGCTGG + Intronic
1049776414 8:144407886-144407908 TGGGTGTCTCATTGTGAGGGAGG + Intronic
1050330876 9:4544885-4544907 TTCCTGCCACCTTGTGAAGGAGG - Intronic
1051668733 9:19489364-19489386 TTCCTGCCACCTTGTGAAGGTGG + Intergenic
1052219185 9:25998699-25998721 TGCCTGTCCAGTTGGCAGGGAGG - Intergenic
1052554329 9:29994484-29994506 TTCCTGCCACCTTGTGAAGGAGG - Intergenic
1053397028 9:37784768-37784790 TGCCGGGCTCCTTGTGACGGAGG + Exonic
1054691624 9:68324152-68324174 TGCCTCTCCCCCTGCGATGGGGG + Intergenic
1057018773 9:91679415-91679437 TGACTGTCCTCCTGTGAGGCTGG + Intronic
1058740464 9:107937566-107937588 TGTCTGTCCCCTAGTGGGGGTGG - Intergenic
1061167688 9:128933672-128933694 TGTCTGTAACCCTGTGAGGGTGG + Intronic
1061496652 9:130978618-130978640 TGCCTGTCCCCCTTGGAGTGAGG - Intergenic
1062077542 9:134599014-134599036 GCCCTGTCCCCATGAGAGGGAGG + Intergenic
1062396110 9:136353551-136353573 CCCCTGCCCCCATGTGAGGGAGG + Intronic
1185952540 X:4452260-4452282 TGACTGTCCCTTTGTGCAGGGGG - Intergenic
1186024457 X:5293666-5293688 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1187931485 X:24297391-24297413 TGCCTGTTGCCGTGTGAGGTGGG - Intergenic
1188018808 X:25134761-25134783 TTCCTGTCACCTTGTGAAGAAGG + Intergenic
1190468358 X:50750024-50750046 TGTCTGTCCTCTTGTGTTGGTGG - Intronic
1191643655 X:63454848-63454870 TTCCTGTCACCTTGTGAAGAAGG - Intergenic
1195242969 X:102971539-102971561 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1195596898 X:106702097-106702119 TGCCTGTACCCAGGGGAGGGGGG - Intronic
1195613004 X:106890411-106890433 TGCTTGCCCCCTTGAGATGGAGG + Intronic
1199346357 X:146745985-146746007 TTCCTGTCGCCTTGTGAAGTTGG - Intergenic
1200963518 Y:9016074-9016096 TGCATGTACCTTTGTGAGGCAGG + Intergenic
1201743870 Y:17350405-17350427 TGGTTGTCCCCTTTTGAGGAGGG - Intergenic