ID: 1037974990

View in Genome Browser
Species Human (GRCh38)
Location 8:23202651-23202673
Sequence ATTTACAAGCTGTACATGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037974981_1037974990 22 Left 1037974981 8:23202606-23202628 CCCTCACTCCACCTCTGGACAAG 0: 1
1: 0
2: 1
3: 14
4: 245
Right 1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 104
1037974984_1037974990 14 Left 1037974984 8:23202614-23202636 CCACCTCTGGACAAGAGGTCCAC 0: 2
1: 0
2: 1
3: 11
4: 130
Right 1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 104
1037974985_1037974990 11 Left 1037974985 8:23202617-23202639 CCTCTGGACAAGAGGTCCACACA 0: 2
1: 0
2: 2
3: 7
4: 103
Right 1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 104
1037974980_1037974990 23 Left 1037974980 8:23202605-23202627 CCCCTCACTCCACCTCTGGACAA 0: 1
1: 0
2: 6
3: 35
4: 338
Right 1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 104
1037974982_1037974990 21 Left 1037974982 8:23202607-23202629 CCTCACTCCACCTCTGGACAAGA 0: 1
1: 1
2: 1
3: 15
4: 211
Right 1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 104
1037974986_1037974990 -5 Left 1037974986 8:23202633-23202655 CCACACATTCTGTACCTGATTTA 0: 3
1: 0
2: 1
3: 17
4: 193
Right 1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037974990 Original CRISPR ATTTACAAGCTGTACATGGG AGG Exonic
900711080 1:4114771-4114793 ATTTCTAAGCTGCACATGTGTGG - Intergenic
904381839 1:30116660-30116682 TTTCACCAGCTGTACATGAGGGG + Intergenic
905393276 1:37651585-37651607 ATGTACAAGCTGCACATGCATGG - Intergenic
906546423 1:46622481-46622503 AGTCACAAGCTGTACTTGTGTGG - Intergenic
907118113 1:51987437-51987459 AATTAAAACCTGTATATGGGAGG + Intronic
910503338 1:87919959-87919981 ATTTACTAGCTATACAATGGTGG + Intergenic
912818819 1:112850621-112850643 ATTTACAAAATGTTCATGGCAGG - Intergenic
916507929 1:165444915-165444937 ATTTAGAAGCTGCACAGGAGAGG - Exonic
920456700 1:206107174-206107196 ATGTACAAGCAGGACATGAGGGG - Intergenic
1063516849 10:6705017-6705039 ATTTCCAAGCAGCACATAGGAGG + Intergenic
1071494364 10:86157619-86157641 AATTCCAAGCTGTCCGTGGGAGG - Intronic
1072400484 10:95093831-95093853 ATGTTCAAGATGTACATGTGTGG - Intergenic
1073227970 10:101940241-101940263 ATTTACAATCTGCACTGGGGTGG + Intronic
1074249405 10:111729582-111729604 ATTGACAAGCCCTACATGGCAGG + Intergenic
1075976109 10:126696923-126696945 ATTTACCAGCTGTTCATGAATGG + Intergenic
1076292701 10:129360113-129360135 AATTATAGGCTGTACATCGGTGG + Intergenic
1083293391 11:61702251-61702273 AATTACAAGCTGAACATGTTAGG + Intronic
1087453606 11:98354498-98354520 ATTAACAAAATGTTCATGGGTGG - Intergenic
1088924219 11:114284310-114284332 ATTTACAAACTGTATAGGAGGGG + Intronic
1092816191 12:12314263-12314285 TTTTACAGGCTGTATATGAGAGG + Intergenic
1093254218 12:16845582-16845604 ATTTACAAGGTTTAAATGGCAGG + Intergenic
1099382917 12:81977064-81977086 ATGTATAGGCTGCACATGGGAGG - Intergenic
1111822428 13:93228883-93228905 ATTTTCAAGCTGTAGAAGTGAGG + Intronic
1115220528 14:31053890-31053912 ATTTACATGATGTACAGAGGAGG + Intronic
1118683547 14:68268368-68268390 AGATACAAAATGTACATGGGAGG - Intronic
1119056741 14:71429970-71429992 TTTTACAATCTGTGCATTGGGGG + Intronic
1120717668 14:87857299-87857321 ATTTCCAAGCTGTTCATAAGAGG - Intronic
1120769731 14:88365929-88365951 AATTACAAAATGTACATGTGAGG + Intergenic
1123769836 15:23518150-23518172 AATTAGAAGCTGTCCATGGAGGG + Intergenic
1125930635 15:43597482-43597504 TCTTACATGCTGAACATGGGGGG - Intronic
1134021817 16:10926283-10926305 ATTTACAAGCTGAACCTGGATGG - Exonic
1143563386 17:7708067-7708089 TTCTACAAGCTGTACCTGGTAGG + Exonic
1148382661 17:47210862-47210884 ATTTACAAGCTGAGCCTGGCAGG + Intronic
1150615149 17:66764675-66764697 ATTTCCCTGCTGCACATGGGAGG - Intronic
1150886142 17:69088442-69088464 ACTTACAAACTGAATATGGGTGG - Intronic
1153414464 18:4831326-4831348 AGTTACAACTTGTAGATGGGGGG + Intergenic
1153602834 18:6798479-6798501 ATTTACAGGCTGGGCATGGCGGG - Intronic
1158303909 18:56083628-56083650 ATATACACTCTCTACATGGGAGG + Intergenic
1163787954 19:19286593-19286615 ACTAAAAAGCTGGACATGGGTGG + Intronic
1166358334 19:42240628-42240650 AGTTACCAGCTCTACAGGGGAGG - Intronic
1168156051 19:54473353-54473375 AATTCCAAGCTGTGCAGGGGAGG - Intergenic
928253525 2:29702310-29702332 ATGTACAAGCTCTACAAGTGAGG + Intronic
929761774 2:44813203-44813225 ATTTACAAAATGCAAATGGGGGG + Intergenic
931383638 2:61776767-61776789 ACTCCCAAGCTGTACATGTGTGG + Intergenic
932538840 2:72629333-72629355 GTTTACAAGCAGTGCATGTGGGG - Intronic
933565258 2:83942735-83942757 ATAAGCAAACTGTACATGGGAGG + Intergenic
938164064 2:129010777-129010799 GTTCACAAGCTGAACATGGCGGG - Intergenic
939523443 2:143261995-143262017 AGTTTCAGGCTGTTCATGGGTGG + Intronic
939864089 2:147453243-147453265 CTTTACATCCTCTACATGGGAGG + Intergenic
940895608 2:159079909-159079931 ATTTATAAGAAGTGCATGGGAGG + Intronic
943612399 2:190048556-190048578 ATATACTAGTTGTACGTGGGGGG - Intronic
944510150 2:200456537-200456559 ATTTACAAGATGGACATTTGGGG - Intronic
1170207804 20:13818157-13818179 AGCAACAAGCTGTCCATGGGTGG + Exonic
1179274799 21:39882436-39882458 TTTTACCAGCTGTACTGGGGAGG + Intronic
1179413645 21:41180838-41180860 ATTTACTAGCTGAACAAGGTGGG - Intronic
1179620407 21:42611567-42611589 ATTTAAAAGCTTTACCTGGTTGG + Intergenic
1180204243 21:46247651-46247673 ATTTAAAATATGAACATGGGTGG - Intronic
1180975419 22:19845346-19845368 ATTCACAGGCTGTGCATAGGGGG - Intronic
1183364778 22:37401083-37401105 AATTACAAGCGGAACATGCGGGG + Intronic
950270757 3:11613011-11613033 ATTTATAAGCTCTACCAGGGAGG - Intronic
957546495 3:81644792-81644814 AATTGCAAGTTGGACATGGGTGG + Intronic
961810318 3:129518319-129518341 ACTTGCAGGCTGGACATGGGAGG + Intronic
963457682 3:145565721-145565743 ATATTCAAGTTATACATGGGAGG - Intergenic
964624056 3:158742152-158742174 ATGTACAAGCAGCACTTGGGTGG - Intronic
964896258 3:161599980-161600002 ATTTACAATCTGTAAATGATGGG - Intergenic
965503150 3:169480371-169480393 ATTTACAAGGTGTATACAGGTGG + Intronic
975984400 4:80189330-80189352 ACTTGCAAGCTGGGCATGGGAGG + Intronic
976225413 4:82791959-82791981 ATTTAAAAGCTGTGCCTGGCCGG + Intronic
976868202 4:89757038-89757060 ATATTCAAGATGTTCATGGGAGG + Intronic
979673793 4:123388930-123388952 ATTTACAAGACTTACATGAGTGG - Intergenic
983097784 4:163585028-163585050 GTTTACAAGCTGTTCTTCGGTGG + Intronic
983686724 4:170418721-170418743 ATTTAAAAGCTTCACATTGGGGG + Intergenic
987883387 5:23779688-23779710 CTCTACAAGGTGTACATGGAAGG + Intergenic
990255786 5:53967475-53967497 ATTTAGAAACTGGATATGGGAGG + Intronic
990362894 5:55039125-55039147 ATTTACAAAATATACATGGATGG - Intergenic
991523007 5:67521632-67521654 ATATACAAGCTATACAGGTGTGG + Intergenic
992775340 5:80084199-80084221 ATCTCCAGGCTGTACATGAGAGG - Intergenic
996703304 5:126471417-126471439 TTTTACAAGCTGTAAATTGCTGG + Intronic
1001275530 5:170348239-170348261 TTTTACAGGCTGAACAGGGGAGG - Intergenic
1001842864 5:174894139-174894161 AATTAGAAGCTATTCATGGGTGG - Intergenic
1006452460 6:34113039-34113061 ATGTAAAAGCTGTAAATGGAAGG - Intronic
1011488235 6:87865551-87865573 GTTTACAAGGTGTAAAAGGGTGG - Intergenic
1012900340 6:104997726-104997748 ATTTATAATCTGCACATGGCCGG + Intronic
1013872683 6:114785812-114785834 ATGTAGAAGCTGGACATGGCAGG - Intergenic
1014219111 6:118782087-118782109 ATTTACAATCTGCCCCTGGGCGG - Intergenic
1015971789 6:138749720-138749742 TTTTAAAAGCTGAACACGGGGGG + Intergenic
1016140543 6:140603928-140603950 ATTTATAAACTGTATATGTGAGG + Intergenic
1016374093 6:143402877-143402899 ATTTACAAGCTGGCCAGGCGTGG - Intergenic
1017797544 6:157859965-157859987 ATTTACAAACTGCACATGACAGG - Intronic
1021539260 7:21738655-21738677 ATTTACATTCTGTTGATGGGTGG + Intronic
1022873829 7:34507302-34507324 ATTGACAATATGTAAATGGGTGG + Intergenic
1028230062 7:88296454-88296476 ATTTAACAGCTGTAAATAGGAGG + Intronic
1030442933 7:109611792-109611814 ATTAACAAGTTGTAAATGAGAGG - Intergenic
1030850617 7:114481240-114481262 ATTTAAAATATGTACATGAGGGG - Intronic
1032570344 7:132989505-132989527 ATATACAATGTGTAAATGGGAGG - Intronic
1034844054 7:154427717-154427739 ATTTGCAAGCTGTTCATGGAAGG + Intronic
1037967993 8:23148441-23148463 ATTTACAAACTGTACATAGCAGG + Exonic
1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG + Exonic
1039406096 8:37313948-37313970 GTTTACAAAGTGTGCATGGGAGG + Intergenic
1039906890 8:41792980-41793002 ATTCAGAAACTCTACATGGGTGG - Intronic
1045225768 8:100244353-100244375 ATTAAGAGGCTGGACATGGGAGG - Intronic
1045776578 8:105810518-105810540 ATTTACGATCTTGACATGGGGGG - Intergenic
1046709750 8:117497083-117497105 ATTTAGAAGTTGTGCATGGTGGG - Intergenic
1054960289 9:70960672-70960694 ATTTACAAGCATAGCATGGGTGG + Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1193411887 X:81174937-81174959 ATTCTCAAGCTGTACAAGGTAGG + Intronic
1195085881 X:101413370-101413392 ATATAAAAGCTGTACATTTGTGG + Exonic
1199319334 X:146419907-146419929 ATTGATAAGCAGTACATTGGAGG + Intergenic