ID: 1037977913

View in Genome Browser
Species Human (GRCh38)
Location 8:23226090-23226112
Sequence GAACTCCCAGGGCGACCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037977903_1037977913 13 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1037977903 8:23226054-23226076 CCCGAAAGCCACGCGAGTCACGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1037977913 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1037977906_1037977913 5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1037977906 8:23226062-23226084 CCACGCGAGTCACGGTCCTGCCT 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1037977913 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1037977902_1037977913 16 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1037977902 8:23226051-23226073 CCTCCCGAAAGCCACGCGAGTCA 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1037977913 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1037977905_1037977913 12 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1037977905 8:23226055-23226077 CCGAAAGCCACGCGAGTCACGGT 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1037977913 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037977913 Original CRISPR GAACTCCCAGGGCGACCTTG GGG Intergenic
900196869 1:1381017-1381039 CAAGTGCCAGGGCGACCTTGGGG + Intergenic
914332936 1:146689290-146689312 GCACTCCCAGGGTGACTTTAGGG - Intergenic
919743544 1:200994728-200994750 GAACTCCCAGGGAGACAGAGTGG + Intronic
922717951 1:227886787-227886809 GAGCTCCCAGGGCGACCCCCAGG - Intergenic
924834874 1:247638150-247638172 GGAATCCCAGGGCCACTTTGGGG + Intergenic
1069832006 10:71287314-71287336 TCACTCCCAGGGTGACCCTGGGG + Intronic
1072903530 10:99430451-99430473 CCACTCCCAGGTTGACCTTGCGG + Exonic
1075037182 10:119079834-119079856 CAACTCCCGGAGTGACCTTGGGG + Intronic
1077323836 11:1954816-1954838 GGAATCCCAGGGCGCCCTGGGGG - Intronic
1078107385 11:8366716-8366738 GAGCTCCCAGTTCCACCTTGGGG + Intergenic
1079129284 11:17738121-17738143 TAGCTCCCTGGGTGACCTTGGGG - Intronic
1082005345 11:47415975-47415997 GAGCTCCCAGGGCAGCCCTGAGG - Exonic
1082776609 11:57249894-57249916 GAGCACCCAGCGCCACCTTGTGG + Intergenic
1087313371 11:96577113-96577135 GAACACCTAGGGGGATCTTGGGG - Intergenic
1090700322 11:129289108-129289130 AGACTCACAGAGCGACCTTGGGG + Intergenic
1202806822 11_KI270721v1_random:10011-10033 GGAATCCCAGGGCGCCCTGGGGG - Intergenic
1096685484 12:53285851-53285873 GCACTTCCTGAGCGACCTTGGGG - Intronic
1100009761 12:89939166-89939188 GAACACCCAGGGTGACGATGAGG - Intergenic
1102068138 12:109996041-109996063 GAGGTCCCTGGGCGGCCTTGGGG - Intronic
1102707473 12:114894768-114894790 GAATACCAAGGGAGACCTTGAGG - Intergenic
1103081435 12:118027052-118027074 GAACTCCTGGGGCCACCTTCAGG - Intronic
1104079069 12:125414643-125414665 GAAGTCCCAGCGGGCCCTTGTGG + Intronic
1114851685 14:26390030-26390052 TAACTCCCAGGCAGTCCTTGTGG + Intergenic
1114998723 14:28393828-28393850 GAACTTCCAGTGCAATCTTGAGG + Intergenic
1118747307 14:68783752-68783774 GAAGTCACAGAGTGACCTTGAGG + Intergenic
1119759167 14:77139507-77139529 GAACTCCCCAGACGACCTGGGGG - Exonic
1119842067 14:77800531-77800553 GAACTCACAGGGCCACCAGGGGG - Intronic
1122134770 14:99626545-99626567 GAGCTCACAGGGCCAGCTTGGGG - Intergenic
1122348318 14:101073775-101073797 GAACCCCCAGGGAGACCCTTCGG + Intergenic
1125761623 15:42100154-42100176 CCACTCCCAGGGTGACCTGGGGG - Intergenic
1131960790 15:97788375-97788397 GACTTTCCAGGGCCACCTTGCGG - Intergenic
1132826087 16:1906393-1906415 GAACTCACAGGGCAAGCTGGGGG - Intergenic
1133013822 16:2929780-2929802 GAACTCCCTGGGCTTCCTGGGGG - Exonic
1140000681 16:71021954-71021976 GCACTCCCAGGGTGACTTTAGGG + Intronic
1141630853 16:85287256-85287278 GAGCTCCCAGGGTGGCCTTTCGG + Intergenic
1146446290 17:32935595-32935617 TAACTCCCAGGTGGACCTTTGGG + Intronic
1149682925 17:58518137-58518159 GAAATCACAGCGCGTCCTTGCGG + Intergenic
1150574172 17:66415474-66415496 GGACTTCCAGGGCTACCTTTGGG - Intronic
1150815447 17:68388982-68389004 TAACTCCCTGGGCTACCTCGTGG + Intronic
1152345057 17:79746542-79746564 GAACTACCAGGGCTCACTTGGGG - Intergenic
1157602345 18:48901973-48901995 GAACTGCCAGGCCAACCCTGGGG + Intergenic
1160155432 18:76430071-76430093 GAACTTCCTGGGCCACCTTCTGG + Intronic
1160910675 19:1472446-1472468 GAACTCCCAGAGCTACCTCTTGG + Exonic
1162361717 19:10224374-10224396 GAACTGCCTGGGCCACCTCGAGG - Exonic
1167444380 19:49528622-49528644 GAACTTCCAGTACGACCATGAGG + Exonic
1167550270 19:50155509-50155531 CAACTCCCAAGGCCACCTTCAGG - Intronic
926547587 2:14261109-14261131 GAACTCCAAGAGCCAACTTGCGG + Intergenic
929939600 2:46323092-46323114 GCACTCCCATGGCGACCTCACGG + Intronic
933457071 2:82530007-82530029 GAACACCCACGGCGATATTGGGG - Intergenic
935072175 2:99704686-99704708 CAACTTCTAGGGTGACCTTGAGG + Intronic
935639674 2:105278986-105279008 GAACTCCCACAGAGACCCTGGGG - Intronic
938779660 2:134573909-134573931 GAACTCTCAGGGTGAACTTCCGG + Intronic
943992063 2:194708767-194708789 GAAATTCCAGGGCAACCTTTAGG + Intergenic
948206352 2:236164595-236164617 GGACTACCGGGGCGTCCTTGGGG + Intergenic
1168752186 20:290483-290505 GAAGACCGAGGGCGACCTCGAGG + Intronic
1169340132 20:4790237-4790259 GAACCCACAGGGGGACTTTGAGG + Intronic
1170080066 20:12464748-12464770 CAACTCCCAGGGATTCCTTGTGG - Intergenic
1171460244 20:25294045-25294067 GAGCTCCCAGGGCCATCCTGGGG + Intronic
1172113857 20:32562616-32562638 GATCTCCCAGGGCTACCCAGAGG - Intronic
1174354709 20:49990072-49990094 GAACTCCCAGGATGACCTGAGGG - Intergenic
1176144734 20:63560493-63560515 GAACTCCAAGGCCAACCTGGAGG - Exonic
1179785618 21:43728184-43728206 AAACTCCCAGGGGGAACTTCTGG - Intronic
1180801819 22:18635469-18635491 GAACTCCCAGGGAGGCACTGGGG + Intergenic
1180853059 22:19031010-19031032 GAACTCCCAGGGAGGCACTGGGG + Intergenic
1181219903 22:21359792-21359814 GAACTCCCAGGGAGGCACTGGGG - Intergenic
1184690614 22:46115685-46115707 CACCTCCCAGGGCGCCCATGAGG + Intergenic
1185262936 22:49880269-49880291 GAACTGCCAGGGCTCCCTGGAGG - Intronic
953180038 3:40586297-40586319 GAACTCCCTGGGAGACCCTGGGG + Intergenic
954639573 3:52089942-52089964 GAACTTCCAGGACTACCATGGGG + Intronic
958729034 3:97940704-97940726 GACCTCCCAGGGCCAACTTATGG + Intronic
967840222 3:193999098-193999120 GAACTCCCAGGACAACCCAGAGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969405812 4:6991002-6991024 GTTCTCCCAGGGCAACCTGGAGG - Intronic
986104160 5:4643887-4643909 GAAATGCCAGGGAGAGCTTGGGG - Intergenic
987862943 5:23508610-23508632 GGAGTCCCAAGGAGACCTTGAGG - Intronic
995240844 5:109884351-109884373 GACCTGCCAGGACGACCGTGTGG - Intronic
1003886845 6:10529424-10529446 GAACTGCCTGGAAGACCTTGTGG + Exonic
1004275102 6:14229229-14229251 GATCTCACAAGGCGGCCTTGAGG + Intergenic
1005986123 6:30876538-30876560 TGACTTCCAGGGTGACCTTGAGG + Intronic
1017012622 6:150072631-150072653 TAAATCCCAGGGCAACCTTCAGG - Intergenic
1017174887 6:151493877-151493899 AAACTGCCAGGGCGACCTGGGGG - Intergenic
1020118829 7:5491623-5491645 GATCTCCAAGGGGGACCCTGGGG - Intronic
1024314943 7:48007185-48007207 GAACACCCATGGAGACCCTGTGG - Exonic
1029366896 7:100122417-100122439 GAACTCCCAGGGCTCCGTTGGGG - Intronic
1031610307 7:123818279-123818301 GAACTCCCAGTACTTCCTTGTGG - Intergenic
1031979232 7:128113876-128113898 GAACTCTCAGGGGGACCTTTTGG + Intergenic
1035465883 7:159076201-159076223 GAACTGCCATGGCCACTTTGGGG + Intronic
1037977913 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG + Intergenic
1038259136 8:25978240-25978262 GAAGCCCCAGGCCCACCTTGAGG + Intronic
1040309084 8:46227362-46227384 AAAGACCCAGGGTGACCTTGAGG + Intergenic
1041843532 8:62299455-62299477 GGACTCCCAGGGCGACCAAGAGG + Intronic
1045831706 8:106469688-106469710 GAACACCAAGGGAGACCTTGAGG - Intronic
1049391960 8:142376283-142376305 GAACCGCAAGGGCGACCCTGGGG + Intronic
1050304674 9:4296454-4296476 GAACTCCAAGGTCCACCTAGTGG - Intronic
1058934883 9:109760820-109760842 AAACTCCCAGGGAGCTCTTGGGG - Intronic
1061609357 9:131736205-131736227 GAGCTCCCAGGGTGAGCTTGTGG - Intronic
1062039774 9:134398901-134398923 GTGCTCCCAGGGCTACCTGGTGG + Intronic
1189281356 X:39821755-39821777 GAACTCCCCGGGCGAGGCTGAGG - Intergenic
1194979733 X:100428085-100428107 GTACTCACAGGGAGACATTGAGG + Intergenic
1195797631 X:108668480-108668502 GGTCTCCCAGGAGGACCTTGGGG - Exonic
1197802734 X:130368681-130368703 TAACTCTCACAGCGACCTTGTGG + Intronic
1198306733 X:135391112-135391134 TAATTCCCAGGGGGACCCTGTGG - Intergenic