ID: 1037980734

View in Genome Browser
Species Human (GRCh38)
Location 8:23251516-23251538
Sequence GCCATGGGCCCTGGGACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037980728_1037980734 -4 Left 1037980728 8:23251497-23251519 CCTACTAGAAGGGAACAGTGCCA 0: 1
1: 0
2: 1
3: 12
4: 94
Right 1037980734 8:23251516-23251538 GCCATGGGCCCTGGGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037980734 Original CRISPR GCCATGGGCCCTGGGACCCT GGG Intronic
No off target data available for this crispr